Transcript: Mouse NM_011774.3

Mus musculus solute carrier family 30 (zinc transporter), member 4 (Slc30a4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Slc30a4 (22785)
Length:
5497
CDS:
244..1536

Additional Resources:

NCBI RefSeq record:
NM_011774.3
NBCI Gene record:
Slc30a4 (22785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079607 CAGAAGATTCACCTTTGGATT pLKO.1 750 CDS 100% 4.950 6.930 N Slc30a4 n/a
2 TRCN0000308535 CAGAAGATTCACCTTTGGATT pLKO_005 750 CDS 100% 4.950 6.930 N Slc30a4 n/a
3 TRCN0000079604 GCATTTATTACTGAACACGTT pLKO.1 1428 CDS 100% 2.640 2.112 N Slc30a4 n/a
4 TRCN0000308453 GCATTTATTACTGAACACGTT pLKO_005 1428 CDS 100% 2.640 2.112 N Slc30a4 n/a
5 TRCN0000079606 CCATCCATATGAACTATGAAA pLKO.1 860 CDS 100% 0.000 0.000 N Slc30a4 n/a
6 TRCN0000308451 CCATCCATATGAACTATGAAA pLKO_005 860 CDS 100% 0.000 0.000 N Slc30a4 n/a
7 TRCN0000038376 CATACGATTCAAGCCAGAATA pLKO.1 1128 CDS 100% 13.200 9.240 N SLC30A4 n/a
8 TRCN0000079603 CCAGAATACAAGATTGCTGAT pLKO.1 1141 CDS 100% 4.050 2.835 N Slc30a4 n/a
9 TRCN0000308533 CCAGAATACAAGATTGCTGAT pLKO_005 1141 CDS 100% 4.050 2.835 N Slc30a4 n/a
10 TRCN0000079605 GCGCTTTAATAAACTTCGAGT pLKO.1 366 CDS 100% 2.640 1.848 N Slc30a4 n/a
11 TRCN0000308536 GCGCTTTAATAAACTTCGAGT pLKO_005 366 CDS 100% 2.640 1.848 N Slc30a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01826 pDONR223 100% 88.8% 91.8% None (many diffs) n/a
2 ccsbBroad304_01826 pLX_304 0% 88.8% 91.8% V5 (many diffs) n/a
3 TRCN0000466033 TTATGATGGGTGCAAACGTCTTGT pLX_317 33.5% 88.8% 91.8% V5 (many diffs) n/a
Download CSV