Transcript: Mouse NM_011781.3

Mus musculus a disintegrin and metallopeptidase domain 25 (testase 2) (Adam25), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Adam25 (23793)
Length:
2632
CDS:
144..2426

Additional Resources:

NCBI RefSeq record:
NM_011781.3
NBCI Gene record:
Adam25 (23793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011781.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032156 CCTAAGACATGCAACATGAAA pLKO.1 2088 CDS 100% 5.625 3.938 N Adam25 n/a
2 TRCN0000087573 CCATTTCCCATGTTCTACCAT pLKO.1 2467 3UTR 100% 3.000 2.100 N LOC382006 n/a
3 TRCN0000032154 GCCCTCCGAACTATACTGAAA pLKO.1 2203 CDS 100% 4.950 2.970 N Adam25 n/a
4 TRCN0000032157 CCAGAGTCTATGGTTGCTATT pLKO.1 543 CDS 100% 10.800 5.400 Y Adam25 n/a
5 TRCN0000192245 CCAGAGTCTATGGTTGCTATT pLKO.1 543 CDS 100% 10.800 5.400 Y Adam39 n/a
6 TRCN0000032158 CCAGAAGTAGTGATACCCTTA pLKO.1 309 CDS 100% 4.050 2.025 Y Adam25 n/a
7 TRCN0000201046 CCAGAAGTAGTGATACCCTTA pLKO.1 309 CDS 100% 4.050 2.025 Y Adam39 n/a
8 TRCN0000087575 CCTATGAGTGAAGAACCCAAA pLKO.1 2346 CDS 100% 4.050 2.025 Y LOC382006 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011781.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.