Transcript: Mouse NM_011812.4

Mus musculus fibulin 5 (Fbln5), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Fbln5 (23876)
Length:
5893
CDS:
370..1716

Additional Resources:

NCBI RefSeq record:
NM_011812.4
NBCI Gene record:
Fbln5 (23876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011812.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319606 CCGATACCCTGGTGCCTATTA pLKO_005 1485 CDS 100% 13.200 18.480 N Fbln5 n/a
2 TRCN0000053560 GCGGATATATGTGTCGCAGTA pLKO.1 1686 CDS 100% 4.050 5.670 N FBLN5 n/a
3 TRCN0000109611 CGAGAGTTCTATATGCGGCAA pLKO.1 1537 CDS 100% 2.160 3.024 N Fbln5 n/a
4 TRCN0000317855 CGAGAGTTCTATATGCGGCAA pLKO_005 1537 CDS 100% 2.160 3.024 N Fbln5 n/a
5 TRCN0000109610 CCCTTAATCATGCTTTCTTAA pLKO.1 2439 3UTR 100% 13.200 9.240 N Fbln5 n/a
6 TRCN0000317792 CCCTTAATCATGCTTTCTTAA pLKO_005 2439 3UTR 100% 13.200 9.240 N Fbln5 n/a
7 TRCN0000319605 TATCGAGGGCCTTACTCAAAT pLKO_005 595 CDS 100% 13.200 9.240 N Fbln5 n/a
8 TRCN0000109614 CCTTATCTGCTGATTGGTGAA pLKO.1 1336 CDS 100% 4.050 2.835 N Fbln5 n/a
9 TRCN0000317791 CCTTATCTGCTGATTGGTGAA pLKO_005 1336 CDS 100% 4.050 2.835 N Fbln5 n/a
10 TRCN0000109612 GATATTGATGAATGTCGCTAT pLKO.1 871 CDS 100% 4.050 2.835 N Fbln5 n/a
11 TRCN0000109613 CCCTCGAACCAACCCAGTGTA pLKO.1 576 CDS 100% 1.650 1.155 N Fbln5 n/a
12 TRCN0000053562 CCAGGATATGAACTTGAGGAA pLKO.1 1069 CDS 100% 2.640 1.584 N FBLN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011812.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07626 pDONR223 100% 89.4% 94.1% None (many diffs) n/a
2 ccsbBroad304_07626 pLX_304 0% 89.4% 94.1% V5 (many diffs) n/a
3 TRCN0000476678 CTCTAATCCCCGTCTACTAGGATA pLX_317 25.6% 89.4% 94.1% V5 (many diffs) n/a
Download CSV