Transcript: Mouse NM_011858.4

Mus musculus teneurin transmembrane protein 4 (Tenm4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tenm4 (23966)
Length:
13186
CDS:
280..8670

Additional Resources:

NCBI RefSeq record:
NM_011858.4
NBCI Gene record:
Tenm4 (23966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011858.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112331 CGCCATTGAATCAGTGGATAA pLKO.1 2034 CDS 100% 10.800 15.120 N Tenm4 n/a
2 TRCN0000112333 CCGTGGGTTATGAGTATGAAT pLKO.1 3770 CDS 100% 5.625 7.875 N Tenm4 n/a
3 TRCN0000112330 GCTAACTTGTCTCGTGTGTAA pLKO.1 9151 3UTR 100% 4.950 6.930 N Tenm4 n/a
4 TRCN0000433746 TTCACCCTTCGGATCCTATAT pLKO_005 5935 CDS 100% 13.200 10.560 N Tenm4 n/a
5 TRCN0000422936 CTATCTGGATAGGGTAGTTAA pLKO_005 2730 CDS 100% 13.200 9.240 N Tenm4 n/a
6 TRCN0000112334 CCTGTTACATACCTTCTACTT pLKO.1 6351 CDS 100% 4.950 3.465 N Tenm4 n/a
7 TRCN0000112332 GCCCATTGATAATGGCCTCAA pLKO.1 5766 CDS 100% 4.050 2.430 N Tenm4 n/a
8 TRCN0000344207 TGCGGGTTCACAACCGAAATC pLKO_005 5852 CDS 100% 10.800 15.120 N TENM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011858.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.