Transcript: Mouse NM_011877.2

Mus musculus protein tyrosine phosphatase, non-receptor type 21 (Ptpn21), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ptpn21 (24000)
Length:
5697
CDS:
358..3888

Additional Resources:

NCBI RefSeq record:
NM_011877.2
NBCI Gene record:
Ptpn21 (24000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011877.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220487 CGGAATAGAATGGGATTATAT pLKO.1 3246 CDS 100% 15.000 21.000 N Ptpn21 n/a
2 TRCN0000298110 CGGAATAGAATGGGATTATAT pLKO_005 3246 CDS 100% 15.000 21.000 N Ptpn21 n/a
3 TRCN0000220490 GCACTAGAGCTGGCAAATAAA pLKO.1 1165 CDS 100% 15.000 10.500 N Ptpn21 n/a
4 TRCN0000293054 GCACTAGAGCTGGCAAATAAA pLKO_005 1165 CDS 100% 15.000 10.500 N Ptpn21 n/a
5 TRCN0000220488 CCGCTTTCTCTCAGGAACTAA pLKO.1 2567 CDS 100% 5.625 3.938 N Ptpn21 n/a
6 TRCN0000293055 CCGCTTTCTCTCAGGAACTAA pLKO_005 2567 CDS 100% 5.625 3.938 N Ptpn21 n/a
7 TRCN0000030008 CCTCAACATTGGCAGTTCCTA pLKO.1 1779 CDS 100% 3.000 2.100 N Ptpn21 n/a
8 TRCN0000298111 CCTCAACATTGGCAGTTCCTA pLKO_005 1779 CDS 100% 3.000 2.100 N Ptpn21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011877.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.