Transcript: Mouse NM_011899.4

Mus musculus signal recognition particle 54A (Srp54a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Srp54a (24067)
Length:
4264
CDS:
274..1788

Additional Resources:

NCBI RefSeq record:
NM_011899.4
NBCI Gene record:
Srp54a (24067)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011899.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282279 CATGTTCAAAGTTAGCATATT pLKO_005 623 CDS 100% 13.200 6.600 Y Srp54b n/a
2 TRCN0000282273 GTTGGTTCATTGATAACTATT pLKO_005 2598 3UTR 100% 13.200 6.600 Y Srp54b n/a
3 TRCN0000262519 TATTGAAGGACTGATTGATAA pLKO_005 1170 CDS 100% 13.200 6.600 Y Srp54b n/a
4 TRCN0000282274 ACATCAGCATTACGCTCATTG pLKO_005 304 CDS 100% 10.800 5.400 Y Srp54b n/a
5 TRCN0000282281 AGTCAATGATGCGGCAGTTTC pLKO_005 1715 CDS 100% 10.800 5.400 Y Srp54b n/a
6 TRCN0000102453 CCAGGGAGAATCCAAAGAGTT pLKO.1 1471 CDS 100% 4.950 2.475 Y Srp54a n/a
7 TRCN0000102451 CCATTATCAATGAAGAGGTAT pLKO.1 335 CDS 100% 4.950 2.475 Y Srp54a n/a
8 TRCN0000102454 CCTGTTTGATATGTGCAGATA pLKO.1 668 CDS 100% 4.950 2.475 Y Srp54a n/a
9 TRCN0000102452 GCATATTATTACCAGAGGAAA pLKO.1 637 CDS 100% 4.950 2.475 Y Srp54a n/a
10 TRCN0000102450 GCGATCAGTAAATTACATGAT pLKO.1 2112 3UTR 100% 4.950 2.475 Y Srp54a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011899.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15599 pDONR223 0% 92.1% 99.8% None (many diffs) n/a
2 ccsbBroad304_15599 pLX_304 0% 92.1% 99.8% V5 (many diffs) n/a
3 TRCN0000468672 ACCATTACCCTAGGTCTATTGGAA pLX_317 30.5% 92.1% 98.4% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_13960 pDONR223 100% 91.9% 98.6% None (many diffs) n/a
5 ccsbBroad304_13960 pLX_304 0% 91.9% 98.6% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000465542 TCAATGTTTCTCCGGTTCTGATCG pLX_317 24.1% 91.9% 98.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV