Transcript: Mouse NM_011922.3

Mus musculus annexin A10 (Anxa10), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Anxa10 (26359)
Length:
1780
CDS:
166..1080

Additional Resources:

NCBI RefSeq record:
NM_011922.3
NBCI Gene record:
Anxa10 (26359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011922.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110660 GCGTGCTGTATTCACACTGAA pLKO.1 1144 3UTR 100% 4.950 3.465 N Anxa10 n/a
2 TRCN0000110663 GTTCGTTGTATCCAGGACAAA pLKO.1 829 CDS 100% 4.950 3.465 N Anxa10 n/a
3 TRCN0000110664 TCAGTTCTGAAGGAACAACTT pLKO.1 370 CDS 100% 4.950 3.465 N Anxa10 n/a
4 TRCN0000110661 CCACCATCTTATGATGCTCAT pLKO.1 433 CDS 100% 4.050 2.430 N Anxa10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011922.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02646 pDONR223 100% 81.5% 79.9% None (many diffs) n/a
2 ccsbBroad304_02646 pLX_304 0% 81.5% 79.9% V5 (many diffs) n/a
3 TRCN0000474748 ACCCATTTAAACCTTCATGAATCA pLX_317 44.2% 81.5% 79.9% V5 (many diffs) n/a
Download CSV