Transcript: Mouse NM_011945.2

Mus musculus mitogen-activated protein kinase kinase kinase 1 (Map3k1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Map3k1 (26401)
Length:
6963
CDS:
15..4496

Additional Resources:

NCBI RefSeq record:
NM_011945.2
NBCI Gene record:
Map3k1 (26401)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361512 TCCGTACCACGTGGTAGTTAA pLKO_005 4480 CDS 100% 13.200 18.480 N Map3k1 n/a
2 TRCN0000025183 GCAGATTCCTTCCGCTTACAA pLKO.1 1643 CDS 100% 5.625 7.875 N Map3k1 n/a
3 TRCN0000025180 CGGTCGAGAGATGGAGAATAA pLKO.1 479 CDS 100% 13.200 17.160 N Map3k1 n/a
4 TRCN0000361511 GGTGAAGCCAATCCCTATTAA pLKO_005 635 CDS 100% 15.000 10.500 N Map3k1 n/a
5 TRCN0000361582 TCAAGGAGTCAGTCGTCATTA pLKO_005 3979 CDS 100% 13.200 9.240 N Map3k1 n/a
6 TRCN0000025182 CCAGTAACATACACAGGCCAA pLKO.1 3118 CDS 100% 2.160 1.512 N Map3k1 n/a
7 TRCN0000025181 CCTCTGTCTTATAGACAGGTT pLKO.1 2273 CDS 100% 0.264 0.185 N Map3k1 n/a
8 TRCN0000025179 GCGCCATTATAGAAATGGCTT pLKO.1 4267 CDS 100% 0.264 0.185 N Map3k1 n/a
9 TRCN0000361513 CTTTGTCTCATGCTCAATTAA pLKO_005 2887 CDS 100% 15.000 9.000 N Map3k1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.