Transcript: Mouse NM_012053.2

Mus musculus ribosomal protein L8 (Rpl8), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rpl8 (26961)
Length:
862
CDS:
50..823

Additional Resources:

NCBI RefSeq record:
NM_012053.2
NBCI Gene record:
Rpl8 (26961)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_012053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054830 CAGCTGAATATCGGCAATGTT pLKO.1 332 CDS 100% 5.625 7.875 N Rpl8 n/a
2 TRCN0000331737 CAGCTGAATATCGGCAATGTT pLKO_005 332 CDS 100% 5.625 7.875 N Rpl8 n/a
3 TRCN0000054828 GCTACATTAAAGGCATCGTAA pLKO.1 165 CDS 100% 4.950 6.930 N Rpl8 n/a
4 TRCN0000301474 GCTACATTAAAGGCATCGTAA pLKO_005 165 CDS 100% 4.950 6.930 N Rpl8 n/a
5 TRCN0000054832 CCCTCCACCATCCGAAGAGAT pLKO.1 713 CDS 100% 1.650 1.320 N Rpl8 n/a
6 TRCN0000301475 CCCTCCACCATCCGAAGAGAT pLKO_005 713 CDS 100% 1.650 1.320 N Rpl8 n/a
7 TRCN0000054829 CAGAATTGACAAGCCTATCTT pLKO.1 568 CDS 100% 5.625 3.938 N Rpl8 n/a
8 TRCN0000301546 CAGAATTGACAAGCCTATCTT pLKO_005 568 CDS 100% 5.625 3.938 N Rpl8 n/a
9 TRCN0000054831 CTACCACAAGTACAAGGCAAA pLKO.1 604 CDS 100% 4.050 2.835 N Rpl8 n/a
10 TRCN0000331735 CTACCACAAGTACAAGGCAAA pLKO_005 604 CDS 100% 4.050 2.835 N Rpl8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01419 pDONR223 100% 87.6% 100% None (many diffs) n/a
2 ccsbBroad304_01419 pLX_304 0% 87.6% 100% V5 (many diffs) n/a
3 TRCN0000469295 CTTAGACTATGTCAGTCCCACAGT pLX_317 58% 87.6% 100% V5 (many diffs) n/a
4 ccsbBroadEn_06876 pDONR223 100% 87.5% 99.6% None (many diffs) n/a
5 ccsbBroad304_06876 pLX_304 0% 87.5% 99.6% V5 (many diffs) n/a
6 TRCN0000469333 AGCTTTGTATACAGGCAGATAGGT pLX_317 61.6% 87.5% 99.6% V5 (many diffs) n/a
Download CSV