Transcript: Human NM_012069.5

Homo sapiens ATPase Na+/K+ transporting family member beta 4 (ATP1B4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ATP1B4 (23439)
Length:
4745
CDS:
81..1142

Additional Resources:

NCBI RefSeq record:
NM_012069.5
NBCI Gene record:
ATP1B4 (23439)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012069.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042849 GCATTATGTGATTAGCCTAAA pLKO.1 596 CDS 100% 10.800 15.120 N ATP1B4 n/a
2 TRCN0000434775 GTAATCTCCCTGTAGCGTAAA pLKO_005 1406 3UTR 100% 10.800 15.120 N ATP1B4 n/a
3 TRCN0000042851 GCACTTTACAGACGTGGTGAA pLKO.1 1010 CDS 100% 4.050 5.670 N ATP1B4 n/a
4 TRCN0000436077 CAAGAAGGCCTGCCAATTTAA pLKO_005 716 CDS 100% 15.000 10.500 N Atp1b4 n/a
5 TRCN0000421593 GGCTTTCTCCAGGGTTATAAT pLKO_005 618 CDS 100% 15.000 10.500 N ATP1B4 n/a
6 TRCN0000042850 CCATCCTTTCCTTACAGTTAT pLKO.1 111 CDS 100% 13.200 9.240 N ATP1B4 n/a
7 TRCN0000421518 TGAAGGGCAAAGGCGTCATAA pLKO_005 1060 CDS 100% 13.200 9.240 N ATP1B4 n/a
8 TRCN0000042852 GTAATCTTTACCCTGAACATA pLKO.1 1113 CDS 100% 5.625 3.938 N ATP1B4 n/a
9 TRCN0000042848 CCTTCTAAAGATGAACCGGAT pLKO.1 809 CDS 100% 2.160 1.512 N ATP1B4 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3179 3UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3143 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012069.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02769 pDONR223 100% 98.8% 98.8% None 316_317insGTCAGAGTTGGA n/a
2 ccsbBroad304_02769 pLX_304 0% 98.8% 98.8% V5 316_317insGTCAGAGTTGGA n/a
3 TRCN0000476479 GGGCACCTGCAGAACGCGGTTGTT pLX_317 35.3% 98.8% 98.8% V5 316_317insGTCAGAGTTGGA n/a
Download CSV