Transcript: Human NM_012081.6

Homo sapiens elongation factor for RNA polymerase II 2 (ELL2), mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
ELL2 (22936)
Length:
5826
CDS:
131..2053

Additional Resources:

NCBI RefSeq record:
NM_012081.6
NBCI Gene record:
ELL2 (22936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012081.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274299 CCCTGGTTCCGTTCTACTAAA pLKO_005 1447 CDS 100% 13.200 18.480 N ELL2 n/a
2 TRCN0000274361 TGGATAAACGTAAGCCTATTT pLKO_005 2460 3UTR 100% 13.200 18.480 N ELL2 n/a
3 TRCN0000017912 CCCTGCAAATACAATTCGAAA pLKO.1 691 CDS 100% 4.950 6.930 N ELL2 n/a
4 TRCN0000274359 CCCTGCAAATACAATTCGAAA pLKO_005 691 CDS 100% 4.950 6.930 N ELL2 n/a
5 TRCN0000017909 GCCGTTCAGAATCTCCTGTAT pLKO.1 1032 CDS 100% 4.950 6.930 N ELL2 n/a
6 TRCN0000203090 GCCACAAGAATTTAATTCCTT pLKO.1 270 CDS 100% 3.000 4.200 N Ell2 n/a
7 TRCN0000274301 GGACCTCTCATATACCTTAAA pLKO_005 892 CDS 100% 13.200 10.560 N ELL2 n/a
8 TRCN0000285192 ACCAACACTAAATGGTCATTT pLKO_005 1165 CDS 100% 13.200 9.240 N ELL2 n/a
9 TRCN0000017908 CCTGGGATTTATACAAGATAA pLKO.1 472 CDS 100% 13.200 9.240 N ELL2 n/a
10 TRCN0000017910 CCAGAATTATAAGGATGACTT pLKO.1 1753 CDS 100% 4.950 3.465 N ELL2 n/a
11 TRCN0000017911 CGACCTTCAATCCAGTTCCAA pLKO.1 293 CDS 100% 3.000 2.100 N ELL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012081.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.