Transcript: Human NM_012087.4

Homo sapiens general transcription factor IIIC subunit 5 (GTF3C5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
GTF3C5 (9328)
Length:
2098
CDS:
16..1575

Additional Resources:

NCBI RefSeq record:
NM_012087.4
NBCI Gene record:
GTF3C5 (9328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012087.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013396 CGCAGCCTATGGATTCGATTT pLKO.1 904 CDS 100% 10.800 15.120 N GTF3C5 n/a
2 TRCN0000013397 CCGAATCCGTTGTGGAATGAA pLKO.1 978 CDS 100% 5.625 7.875 N GTF3C5 n/a
3 TRCN0000274326 CCGAATCCGTTGTGGAATGAA pLKO_005 978 CDS 100% 5.625 7.875 N GTF3C5 n/a
4 TRCN0000274324 CTTCCCTTCATAGCCTATTAC pLKO_005 865 CDS 100% 13.200 9.240 N GTF3C5 n/a
5 TRCN0000274258 TCTCAGGATGAGACCAGTAAA pLKO_005 1863 3UTR 100% 13.200 9.240 N GTF3C5 n/a
6 TRCN0000274325 ATGCCATCTTTGTCAACTTTG pLKO_005 659 CDS 100% 10.800 7.560 N GTF3C5 n/a
7 TRCN0000013395 CGGCAAGCATACGTCAATGTA pLKO.1 432 CDS 100% 5.625 3.938 N GTF3C5 n/a
8 TRCN0000013394 CGGCAGATGTTCTACCAGTTA pLKO.1 1225 CDS 100% 4.950 3.465 N GTF3C5 n/a
9 TRCN0000274260 CGGCAGATGTTCTACCAGTTA pLKO_005 1225 CDS 100% 4.950 3.465 N GTF3C5 n/a
10 TRCN0000086394 GCCAAGATTTATCAAGTCCTT pLKO.1 952 CDS 100% 2.640 1.848 N Gtf3c5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012087.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07389 pDONR223 100% 99.8% 100% None 6G>T;1554C>T n/a
2 ccsbBroad304_07389 pLX_304 0% 99.8% 100% V5 6G>T;1554C>T n/a
3 TRCN0000465761 GGTATCCGCGATAGTTCGACGGTA pLX_317 17.6% 99.8% 100% V5 6G>T;1554C>T n/a
Download CSV