Transcript: Human NM_012106.4

Homo sapiens ADP ribosylation factor like GTPase 2 binding protein (ARL2BP), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ARL2BP (23568)
Length:
1969
CDS:
110..601

Additional Resources:

NCBI RefSeq record:
NM_012106.4
NBCI Gene record:
ARL2BP (23568)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012106.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138629 CGCCTCTGATGCAGAATTTGA pLKO.1 154 CDS 100% 5.625 4.500 N ARL2BP n/a
2 TRCN0000349585 CGCCTCTGATGCAGAATTTGA pLKO_005 154 CDS 100% 5.625 4.500 N ARL2BP n/a
3 TRCN0000135905 GATGACGAGTTCCAGTTATTA pLKO.1 209 CDS 100% 15.000 10.500 N ARL2BP n/a
4 TRCN0000349653 GATGACGAGTTCCAGTTATTA pLKO_005 209 CDS 100% 15.000 10.500 N ARL2BP n/a
5 TRCN0000137685 GCTGCTCACCTTCACAGATTT pLKO.1 442 CDS 100% 13.200 9.240 N ARL2BP n/a
6 TRCN0000135453 GTGACTTCATTGTGCAAATCA pLKO.1 542 CDS 100% 5.625 3.938 N ARL2BP n/a
7 TRCN0000318900 GTGACTTCATTGTGCAAATCA pLKO_005 542 CDS 100% 5.625 3.938 N ARL2BP n/a
8 TRCN0000136335 GCTGTTTGTATGCTTTGGTTT pLKO.1 1681 3UTR 100% 4.950 3.465 N ARL2BP n/a
9 TRCN0000137466 GCAGAATTTGATGCTGTGGTT pLKO.1 164 CDS 100% 2.640 1.848 N ARL2BP n/a
10 TRCN0000138400 CATAAGGATGAAGTGGCTGGT pLKO.1 407 CDS 100% 2.160 1.512 N ARL2BP n/a
11 TRCN0000137806 GCACAGCTTTACTGGCTGTTT pLKO.1 1667 3UTR 100% 0.495 0.347 N ARL2BP n/a
12 TRCN0000318901 GCACAGCTTTACTGGCTGTTT pLKO_005 1667 3UTR 100% 0.495 0.347 N ARL2BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012106.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02798 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02798 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471445 CGGCTAGTCCCACGTTATGAGCAA pLX_317 83.4% 100% 100% V5 n/a
Download CSV