Transcript: Human NM_012134.3

Homo sapiens leiomodin 1 (LMOD1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
LMOD1 (25802)
Length:
3927
CDS:
209..2011

Additional Resources:

NCBI RefSeq record:
NM_012134.3
NBCI Gene record:
LMOD1 (25802)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440941 CAATCTGCTCAGCCGCAACAT pLKO_005 1600 CDS 100% 4.950 6.930 N LMOD1 n/a
2 TRCN0000113866 GCTGTATGAATAGCTGTGTAT pLKO.1 2679 3UTR 100% 4.950 3.960 N LMOD1 n/a
3 TRCN0000113870 CCCTTATCATGGAGAACCTGA pLKO.1 1839 CDS 100% 2.640 2.112 N LMOD1 n/a
4 TRCN0000414385 TCTCTGAGGCTCTCCAAATTT pLKO_005 2201 3UTR 100% 15.000 10.500 N LMOD1 n/a
5 TRCN0000427757 ATGAGATCTTGGTCCGGTTTA pLKO_005 1242 CDS 100% 10.800 7.560 N LMOD1 n/a
6 TRCN0000422297 GCCTTATCTCTTCTCACTTTC pLKO_005 2171 3UTR 100% 10.800 7.560 N LMOD1 n/a
7 TRCN0000113868 CGTCAACAACTCAGACTGCAT pLKO.1 1216 CDS 100% 2.640 1.848 N LMOD1 n/a
8 TRCN0000113867 CTCTCCAAAGAACTCACCCAA pLKO.1 1765 CDS 100% 2.640 1.848 N LMOD1 n/a
9 TRCN0000113869 CCCAGCATATTTGATGAGCCT pLKO.1 1151 CDS 100% 0.660 0.462 N LMOD1 n/a
10 TRCN0000090146 CCCTTATCATGGAGAACCTAA pLKO.1 1839 CDS 100% 4.950 3.960 N Lmod1 n/a
11 TRCN0000090147 GCTCCCAGCATATTTGATGAA pLKO.1 1148 CDS 100% 4.950 3.465 N Lmod1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15770 pDONR223 0% 44.8% 44.8% None 1_84del;669_1577del n/a
2 ccsbBroad304_15770 pLX_304 0% 44.8% 44.8% V5 1_84del;669_1577del n/a
3 TRCN0000465207 GTTTCATACTGTAAGCTGGCCCCG pLX_317 24.3% 44.8% 44.8% V5 1_84del;669_1577del n/a
Download CSV