Transcript: Human NM_012142.5

Homo sapiens cyclin D1 binding protein 1 (CCNDBP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CCNDBP1 (23582)
Length:
3515
CDS:
97..1179

Additional Resources:

NCBI RefSeq record:
NM_012142.5
NBCI Gene record:
CCNDBP1 (23582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012142.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045209 CGTGCGAATCAATTCTGCGAA pLKO.1 1005 CDS 100% 2.640 3.696 N CCNDBP1 n/a
2 TRCN0000432498 GACGATCAAGAGCTCATAATC pLKO_005 802 CDS 100% 13.200 10.560 N CCNDBP1 n/a
3 TRCN0000421822 GATGTTGATGGTCTCAATAAA pLKO_005 1493 3UTR 100% 15.000 10.500 N CCNDBP1 n/a
4 TRCN0000415591 GATTTGGCTCTGAGCATATAT pLKO_005 964 CDS 100% 15.000 10.500 N CCNDBP1 n/a
5 TRCN0000045208 CCTGAGAACAATGACCTTATT pLKO.1 526 CDS 100% 13.200 9.240 N CCNDBP1 n/a
6 TRCN0000045212 CCCAGCAATCAGGACTTGTAT pLKO.1 772 CDS 100% 5.625 3.938 N CCNDBP1 n/a
7 TRCN0000045210 CGAGGAGTTTAATCGAGAGAT pLKO.1 228 CDS 100% 4.950 3.465 N CCNDBP1 n/a
8 TRCN0000045211 CGGATGTTAGTGGCAGAGAAT pLKO.1 871 CDS 100% 4.950 3.465 N CCNDBP1 n/a
9 TRCN0000073773 CCTCTCAAGTAGCTGGGACTA pLKO.1 2745 3UTR 100% 4.050 2.025 Y TINAGL1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2883 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2883 3UTR 100% 5.625 2.813 Y EID2B n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2750 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012142.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02802 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02802 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465921 TGATCCCCCGCCACATTGAGGCCC pLX_317 29.8% 100% 100% V5 n/a
Download CSV