Construct: ORF TRCN0000465921
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017293.1_s317c1
- Derived from:
- ccsbBroadEn_02802
- DNA Barcode:
- TGATCCCCCGCCACATTGAGGCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCNDBP1 (23582)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465921
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23582 | CCNDBP1 | cyclin D1 binding protein 1 | NM_012142.5 | 100% | 100% | |
2 | human | 23582 | CCNDBP1 | cyclin D1 binding protein 1 | XM_006720448.2 | 69.5% | 66.5% | 1_272del;380_381ins140 |
3 | human | 23582 | CCNDBP1 | cyclin D1 binding protein 1 | XR_001751188.2 | 63% | 1_216del;1138_1194del;1354_1713del | |
4 | human | 23582 | CCNDBP1 | cyclin D1 binding protein 1 | XM_024449882.1 | 55.2% | 55.2% | 0_1ins483 |
5 | human | 23582 | CCNDBP1 | cyclin D1 binding protein 1 | XR_429445.2 | 53.3% | (many diffs) | |
6 | human | 23582 | CCNDBP1 | cyclin D1 binding protein 1 | NR_045998.2 | 28.4% | 1_96del;265_266ins80;1097_3435del | |
7 | human | 23582 | CCNDBP1 | cyclin D1 binding protein 1 | NR_027514.3 | 27.9% | 1_96del;426_427ins97;1080_3418del | |
8 | human | 23582 | CCNDBP1 | cyclin D1 binding protein 1 | NR_027513.3 | 25.6% | (many diffs) | |
9 | human | 23582 | CCNDBP1 | cyclin D1 binding protein 1 | NR_045999.2 | 23.9% | (many diffs) | |
10 | mouse | 17151 | Ccndbp1 | cyclin D-type binding-prote... | XM_006498852.3 | 44.2% | 43.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1146
- ORF length:
- 1080
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gagcgcaact gcacctgcag ccgcagtccc caccctggct tcgcctttgg 121 agcagctccg gcacttggcg gaggagctgc ggttgctcct gcctcgagtg cgggtcggcg 181 aagcccagga gaccaccgag gagtttaatc gagagatgtt ctggagaaga ctcaatgagg 241 cagctgtgac tgtgtcaagg gaagccacga ctctgaccat agtcttctct cagcttccac 301 tgccgtctcc acaggaaacc cagaagttct gtgaacaagt ccatgctgcc atcaaggcat 361 ttattgcagt gtactatttg cttccaaagg atcaggggat caccctgaga aagctggtac 421 ggggcgccac cctggacatc gtggatggca tggctcagct catggaagta ctttccgtca 481 ctccaactca gagccctgag aacaatgacc ttatttccta caacagtgtc tgggttgcgt 541 gccagcagat gcctcagata ccaagagata acaaagctgc agctcttttg atgctgacca 601 agaatgtgga ttttgtgaag gatgcacatg aagaaatgga gcaggctgtg gaagaatgtg 661 acccttactc tggcctcttg aatgatactg aggagaacaa ctctgacaac cacaatcatg 721 aggatgatgt gttggggttt cccagcaatc aggacttgta ttggtcagag gacgatcaag 781 agctcataat cccatgcctt gcgctggtga gagcatccaa agcctgccTG AAGAAAATTC 841 GGATGTTAGT GGCAGAGAAT GGGAAGAAGG ATCAGGTGGC ACAGCTGGAT GACATTGTGG 901 ATATTTCTGA TGAAATCAGC CCTAGTGTGG ATGATTTGGC TCTGAGCATA TATCCACCTA 961 TGTGTCACCT GACCGTGCGA ATCAATTCTG CGAAACTTGT ATCTGTTTTA AAGAAGGCAC 1021 TTGAAATTAC AAAAGCAAGT CATGTGACCC CTCAGCCAGA AGATAGTTGG ATCCCTTTAC 1081 TTATTAATGC CATTGATCAT TGCATGAATA GAATCAAGGA GCTCACTCAG AGTGAACTTG 1141 AATTATGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1201 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1261 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATGATCCCCC GCCACATTGA GGCCCACGCG 1321 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt