Transcript: Human NM_012179.4

Homo sapiens F-box protein 7 (FBXO7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FBXO7 (25793)
Length:
2060
CDS:
193..1761

Additional Resources:

NCBI RefSeq record:
NM_012179.4
NBCI Gene record:
FBXO7 (25793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012179.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293512 GAACAACCAAGTGATTCATTC pLKO_005 544 CDS 100% 10.800 15.120 N FBXO7 n/a
2 TRCN0000004341 CCATCGTCAACTCACACCATT pLKO.1 1438 CDS 100% 4.950 6.930 N FBXO7 n/a
3 TRCN0000004337 CGCCTAATATACCTTCATCCA pLKO.1 443 CDS 100% 2.640 3.696 N FBXO7 n/a
4 TRCN0000004338 GCCACATTCATTAGAGACCTT pLKO.1 729 CDS 100% 2.640 2.112 N FBXO7 n/a
5 TRCN0000298512 GCCACATTCATTAGAGACCTT pLKO_005 729 CDS 100% 2.640 2.112 N FBXO7 n/a
6 TRCN0000293442 TGTCATTCATGTGATTGATTT pLKO_005 1748 CDS 100% 13.200 9.240 N FBXO7 n/a
7 TRCN0000293444 GAGAGTTGCACTCCCAGAAAC pLKO_005 1869 3UTR 100% 10.800 7.560 N FBXO7 n/a
8 TRCN0000293514 TGTTGGAGTCAGGTTACATAC pLKO_005 812 CDS 100% 10.800 7.560 N FBXO7 n/a
9 TRCN0000004340 GCTGACTGTTCTGATGCCAAT pLKO.1 760 CDS 100% 4.050 2.835 N FBXO7 n/a
10 TRCN0000004339 CCCTGCTCTTGGTTCTCCTCT pLKO.1 1983 3UTR 100% 0.880 0.616 N FBXO7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012179.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07941 pDONR223 100% 99.8% 99.8% None 345G>A;949C>T n/a
2 ccsbBroad304_07941 pLX_304 0% 99.8% 99.8% V5 345G>A;949C>T n/a
3 TRCN0000471539 ACTCCAACAGTGTCAACTCATGGC pLX_317 29.5% 99.8% 99.8% V5 345G>A;949C>T n/a
Download CSV