Transcript: Human NM_012242.4

Homo sapiens dickkopf WNT signaling pathway inhibitor 1 (DKK1), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
DKK1 (22943)
Length:
1805
CDS:
155..955

Additional Resources:

NCBI RefSeq record:
NM_012242.4
NBCI Gene record:
DKK1 (22943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033384 CGGGAATAAGTACCAGACCAT pLKO.1 364 CDS 100% 2.640 3.696 N DKK1 n/a
2 TRCN0000033385 CGGTTCTCAATTCCAACGCTA pLKO.1 258 CDS 100% 2.640 3.696 N DKK1 n/a
3 TRCN0000290070 CGGTTCTCAATTCCAACGCTA pLKO_005 258 CDS 100% 2.640 3.696 N DKK1 n/a
4 TRCN0000296461 ACACTTGTCAGAGACACTAAA pLKO_005 936 CDS 100% 13.200 9.240 N DKK1 n/a
5 TRCN0000296460 TGTTATCTTGACTGACAAATA pLKO_005 1272 3UTR 100% 13.200 9.240 N DKK1 n/a
6 TRCN0000033388 CCAGAAGAACCACCTTGTCTT pLKO.1 660 CDS 100% 4.950 3.465 N DKK1 n/a
7 TRCN0000290003 CCAGAAGAACCACCTTGTCTT pLKO_005 660 CDS 100% 4.950 3.465 N DKK1 n/a
8 TRCN0000033386 CCTGTCCTGAAAGAAGGTCAA pLKO.1 788 CDS 100% 4.050 2.835 N DKK1 n/a
9 TRCN0000290069 CCTGTCCTGAAAGAAGGTCAA pLKO_005 788 CDS 100% 4.050 2.835 N DKK1 n/a
10 TRCN0000033387 GCCAGTAATTCTTCTAGGCTT pLKO.1 914 CDS 100% 2.640 1.848 N DKK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02706 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02706 pLX_304 83.8% 100% 100% V5 n/a
3 TRCN0000472403 TTCCATCTCTTCGTTCTGGCGCGT pLX_317 38.5% 100% 100% V5 n/a
Download CSV