Transcript: Human NM_012249.4

Homo sapiens ras homolog family member Q (RHOQ), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
RHOQ (23433)
Length:
4780
CDS:
558..1175

Additional Resources:

NCBI RefSeq record:
NM_012249.4
NBCI Gene record:
RHOQ (23433)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012249.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047590 CCTACTCATGAGCTATGCCAA pLKO.1 629 CDS 100% 2.640 3.696 N RHOQ n/a
2 TRCN0000308154 TCTGAAGCCACAATCTATTAT pLKO_005 1364 3UTR 100% 15.000 10.500 N RHOQ n/a
3 TRCN0000047588 GCAAGACTGAATGATATGAAA pLKO.1 954 CDS 100% 5.625 3.938 N RHOQ n/a
4 TRCN0000289569 GCAAGACTGAATGATATGAAA pLKO_005 954 CDS 100% 5.625 3.938 N RHOQ n/a
5 TRCN0000047592 ACTCAGATTGATCTCCGAGAT pLKO.1 918 CDS 100% 4.050 2.835 N RHOQ n/a
6 TRCN0000289570 ACTCAGATTGATCTCCGAGAT pLKO_005 918 CDS 100% 4.050 2.835 N RHOQ n/a
7 TRCN0000047589 CGGTGGTAAATCCAGCCTCAT pLKO.1 823 CDS 100% 4.050 2.835 N RHOQ n/a
8 TRCN0000047591 GAGGCCTTTATCTTACCCAAT pLKO.1 776 CDS 100% 4.050 2.430 N RHOQ n/a
9 TRCN0000289568 GAGGCCTTTATCTTACCCAAT pLKO_005 776 CDS 100% 4.050 2.430 N RHOQ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012249.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02767 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02767 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468701 ATATGACCATCACTCATCACCCGG pLX_317 66.1% 100% 100% V5 n/a
Download CSV