Transcript: Human NM_012316.5

Homo sapiens karyopherin subunit alpha 6 (KPNA6), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
KPNA6 (23633)
Length:
7355
CDS:
76..1686

Additional Resources:

NCBI RefSeq record:
NM_012316.5
NBCI Gene record:
KPNA6 (23633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012316.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293167 GAGGGCTTCCAGCTATAATAT pLKO_005 1669 CDS 100% 15.000 21.000 N KPNA6 n/a
2 TRCN0000293220 GCCTGGGCTCTAACGAATATT pLKO_005 511 CDS 100% 15.000 21.000 N KPNA6 n/a
3 TRCN0000293221 TACTTGAGCAGACGGTATATT pLKO_005 2126 3UTR 100% 15.000 21.000 N KPNA6 n/a
4 TRCN0000065046 CGGAGAAATGTGGAGCTGATT pLKO.1 223 CDS 100% 4.950 6.930 N KPNA6 n/a
5 TRCN0000286142 CGGAGAAATGTGGAGCTGATT pLKO_005 223 CDS 100% 4.950 6.930 N KPNA6 n/a
6 TRCN0000065044 CCTGTGTTGATCGAAATCCTT pLKO.1 1216 CDS 100% 3.000 2.400 N KPNA6 n/a
7 TRCN0000286141 CCTGTGTTGATCGAAATCCTT pLKO_005 1216 CDS 100% 3.000 2.400 N KPNA6 n/a
8 TRCN0000313193 TGGAGGGCTTCCAGCTATAAT pLKO_005 1667 CDS 100% 15.000 10.500 N Kpna6 n/a
9 TRCN0000065045 CCCAGGTCATTCTTAACTGTT pLKO.1 1061 CDS 100% 4.950 3.465 N KPNA6 n/a
10 TRCN0000065043 GCTGCCATGTTCGATAGTCTT pLKO.1 253 CDS 100% 4.950 3.465 N KPNA6 n/a
11 TRCN0000065047 CAATCCTTATTGTGGCCTCAT pLKO.1 1464 CDS 100% 4.050 2.835 N KPNA6 n/a
12 TRCN0000093284 CCTCCAATAGATGAAGTTATT pLKO.1 415 CDS 100% 13.200 9.240 N Kpna6 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6315 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 6358 3UTR 100% 4.950 2.475 Y NLRP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012316.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02814 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02814 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470815 CATGGCTCTAGCCCCATGACTGTC pLX_317 27.1% 100% 100% V5 n/a
Download CSV