Transcript: Human NM_012324.6

Homo sapiens mitogen-activated protein kinase 8 interacting protein 2 (MAPK8IP2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MAPK8IP2 (23542)
Length:
5700
CDS:
27..2501

Additional Resources:

NCBI RefSeq record:
NM_012324.6
NBCI Gene record:
MAPK8IP2 (23542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012324.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431685 GTTTGAGATGATCGATGACAA pLKO_005 266 CDS 100% 4.950 6.930 N MAPK8IP2 n/a
2 TRCN0000037989 CCTAAACAACAACGGAGGCTT pLKO.1 479 CDS 100% 2.640 3.696 N MAPK8IP2 n/a
3 TRCN0000433797 TATCCTCTATTCTTCACTTTG pLKO_005 2815 3UTR 100% 10.800 7.560 N MAPK8IP2 n/a
4 TRCN0000037993 CAAGAAGTTCCTCAATGTCTT pLKO.1 1745 CDS 100% 4.950 3.465 N MAPK8IP2 n/a
5 TRCN0000037990 CAGCCATTTCTTCCAGATGAA pLKO.1 2270 CDS 100% 4.950 3.465 N MAPK8IP2 n/a
6 TRCN0000037991 GAAGAATTTGACGACGAAGAT pLKO.1 114 CDS 100% 4.950 3.465 N MAPK8IP2 n/a
7 TRCN0000037992 CCAGATGAAGAACATCTCCTT pLKO.1 2282 CDS 100% 0.264 0.185 N MAPK8IP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012324.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11744 pDONR223 100% 53.7% 53.7% None 265_1407del n/a
2 ccsbBroad304_11744 pLX_304 0% 53.7% 53.7% V5 265_1407del n/a
3 TRCN0000471059 AACAGATTTCATCTCAGGATACAG pLX_317 27.3% 53.7% 53.7% V5 265_1407del n/a
Download CSV