Transcript: Human NM_012341.3

Homo sapiens GTP binding protein 4 (GTPBP4), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
GTPBP4 (23560)
Length:
4656
CDS:
47..1951

Additional Resources:

NCBI RefSeq record:
NM_012341.3
NBCI Gene record:
GTPBP4 (23560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012341.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247929 TGTTGGGCACATGGATTATAA pLKO_005 664 CDS 100% 15.000 21.000 N Gtpbp4 n/a
2 TRCN0000294070 TGTCGGAATCCCGTGCTTAAA pLKO_005 2300 3UTR 100% 13.200 18.480 N GTPBP4 n/a
3 TRCN0000047975 CCAACCGTTATTCATAAACAT pLKO.1 137 CDS 100% 5.625 7.875 N GTPBP4 n/a
4 TRCN0000047976 GCGTAGTCTTGGTGTTGACAT pLKO.1 1618 CDS 100% 4.950 6.930 N GTPBP4 n/a
5 TRCN0000286716 GCGTAGTCTTGGTGTTGACAT pLKO_005 1618 CDS 100% 4.950 6.930 N GTPBP4 n/a
6 TRCN0000047974 GCTGGAGAGTATGACAGTGTA pLKO.1 1433 CDS 100% 4.950 6.930 N GTPBP4 n/a
7 TRCN0000286790 GCTGGAGAGTATGACAGTGTA pLKO_005 1433 CDS 100% 4.950 6.930 N GTPBP4 n/a
8 TRCN0000047973 GCGTCAGCATTTATCCCGTTT pLKO.1 508 CDS 100% 4.050 5.670 N GTPBP4 n/a
9 TRCN0000286714 GCGTCAGCATTTATCCCGTTT pLKO_005 508 CDS 100% 4.050 5.670 N GTPBP4 n/a
10 TRCN0000047977 GCTCATCGAGTGGAAACCAAA pLKO.1 1067 CDS 100% 4.950 3.960 N GTPBP4 n/a
11 TRCN0000286791 GCTCATCGAGTGGAAACCAAA pLKO_005 1067 CDS 100% 4.950 3.960 N GTPBP4 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3271 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012341.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07905 pDONR223 100% 99.9% 100% None 750G>A n/a
Download CSV