Transcript: Human NM_012399.5

Homo sapiens phosphatidylinositol transfer protein beta (PITPNB), transcript variant sp1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
PITPNB (23760)
Length:
2914
CDS:
66..881

Additional Resources:

NCBI RefSeq record:
NM_012399.5
NBCI Gene record:
PITPNB (23760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012399.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154019 CCATGTTCTGTTCAGGAGTAT pLKO.1 99 CDS 100% 4.950 6.930 N PITPNB n/a
2 TRCN0000344281 CCATGTTCTGTTCAGGAGTAT pLKO_005 99 CDS 100% 4.950 6.930 N PITPNB n/a
3 TRCN0000153977 CCAGACTTGGGAACATTAGAA pLKO.1 414 CDS 100% 5.625 4.500 N PITPNB n/a
4 TRCN0000153768 CAAACCAGACTTGGGAACATT pLKO.1 410 CDS 100% 5.625 3.938 N PITPNB n/a
5 TRCN0000157864 CCTGCATTCGTGAGGATGATT pLKO.1 270 CDS 100% 5.625 3.938 N PITPNB n/a
6 TRCN0000344282 CCTGCATTCGTGAGGATGATT pLKO_005 270 CDS 100% 5.625 3.938 N PITPNB n/a
7 TRCN0000151158 GACTGCAAAGCAAAGTAGAAA pLKO.1 676 CDS 100% 5.625 3.938 N PITPNB n/a
8 TRCN0000344284 GACTGCAAAGCAAAGTAGAAA pLKO_005 676 CDS 100% 5.625 3.938 N PITPNB n/a
9 TRCN0000157320 CAAACTTCCATCGCCAGCTTT pLKO.1 730 CDS 100% 4.950 3.465 N PITPNB n/a
10 TRCN0000151737 CCCACATTTCATACATCCTTT pLKO.1 2519 3UTR 100% 4.950 3.465 N PITPNB n/a
11 TRCN0000156381 CGATCTCACGATGGAAGACAT pLKO.1 773 CDS 100% 4.950 3.465 N PITPNB n/a
12 TRCN0000156275 CCAGCAGACTACAAAGCTGAT pLKO.1 516 CDS 100% 4.050 2.835 N PITPNB n/a
13 TRCN0000344283 CCAGCAGACTACAAAGCTGAT pLKO_005 516 CDS 100% 4.050 2.835 N PITPNB n/a
14 TRCN0000153380 GCTAGTAAGAATGAGACTGGT pLKO.1 150 CDS 100% 2.640 1.848 N PITPNB n/a
15 TRCN0000153460 GAAGACGAGACTCAGAAAGAA pLKO.1 804 CDS 100% 5.625 3.375 N PITPNB n/a
16 TRCN0000344285 GAAGACGAGACTCAGAAAGAA pLKO_005 804 CDS 100% 5.625 3.375 N PITPNB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012399.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02839 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02839 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476324 CATATATGCGCCAATTGACGGGCC pLX_317 52.5% 100% 100% V5 n/a
4 ccsbBroadEn_11758 pDONR223 100% 95.7% 97.4% None (many diffs) n/a
5 ccsbBroad304_11758 pLX_304 0% 95.7% 97.4% V5 (many diffs) n/a
6 TRCN0000473348 CCACGAACCCGACGTCCAATGATG pLX_317 50.1% 95.7% 97.4% V5 (many diffs) n/a
Download CSV