Construct: ORF TRCN0000473348
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008342.1_s317c1
- Derived from:
- ccsbBroadEn_11758
- DNA Barcode:
- CCACGAACCCGACGTCCAATGATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PITPNB (23760)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473348
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23760 | PITPNB | phosphatidylinositol transf... | NM_001284277.1 | 100% | 100% | |
2 | human | 23760 | PITPNB | phosphatidylinositol transf... | XM_011530052.2 | 98.5% | 97% | (many diffs) |
3 | human | 23760 | PITPNB | phosphatidylinositol transf... | NM_012399.5 | 95.7% | 97.4% | (many diffs) |
4 | human | 23760 | PITPNB | phosphatidylinositol transf... | NM_001284278.1 | 94.3% | 94.5% | (many diffs) |
5 | human | 23760 | PITPNB | phosphatidylinositol transf... | XM_017028707.1 | 64.2% | 56.9% | (many diffs) |
6 | human | 23760 | PITPNB | phosphatidylinositol transf... | XR_001755190.1 | 26.1% | (many diffs) | |
7 | human | 23760 | PITPNB | phosphatidylinositol transf... | XR_002958679.1 | 12.5% | (many diffs) | |
8 | mouse | 56305 | Pitpnb | phosphatidylinositol transf... | NM_001301643.1 | 91% | 97% | (many diffs) |
9 | mouse | 56305 | Pitpnb | phosphatidylinositol transf... | NM_019640.5 | 89.3% | 95.5% | (many diffs) |
10 | mouse | 56305 | Pitpnb | phosphatidylinositol transf... | NM_001301666.1 | 81.6% | 86.7% | (many diffs) |
11 | mouse | 56305 | Pitpnb | phosphatidylinositol transf... | XM_006535143.1 | 66.6% | 70.5% | (many diffs) |
12 | mouse | 56305 | Pitpnb | phosphatidylinositol transf... | NM_001301644.1 | 65.1% | 69.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 882
- ORF length:
- 816
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gctgatcaag gaattccgtg tggttttgcc atgttctgtt caggagtatc 121 aggttgggca gctttactct gttgcagaag ctagtaagaa tgagactggt ggtggagaag 181 gaattgaagt cttaaagaat gaaccttatg agaaggatgg agaaaaggga cagtatacgc 241 acaaaattta tcacctaaag agcaaagtgc ctgcattcgt gaggatgatt gctcccgagg 301 gctccttggt gtttcatgag aaagcctgga atgcgtaccc ctactgtaga acaattgtaa 361 cgaatgaata tatgaaagat gatttcttca ttaaaatcga aacatggcac aaaccagact 421 tgggaacatt agaaaatgta catggtttag atccaaacac atggaaaact gttGAAATTG 481 TCCATATAGA TATTGCAGAT AGAAGTCAAG TTGAACCAGC AGACTACAAA GCTGATGAAG 541 ACCCAGCATT ATTCCAGTCA GTCAAGACCA AGAGAGGCCC TTTGGGACCC AACTGGAAGA 601 AGGAGCTGGC AAACAGCCCT GACTGTCCCC AGATGTGTGC CTATAAGCTG GTGACCATCA 661 AATTCAAGTG GTGGGGACTG CAAAGCAAAG TAGAAAACTT CATTCAAAAG CAAGAAAAAC 721 GGATATTTAC AAACTTCCAT CGCCAGCTTT TTTGTTGGAT TGACAAGTGG ATCGATCTCA 781 CGATGGAAGA CATTAGGAGA ATGGAAGACG AGACTCAGAA AGAACTAGAA ACATTACGTA 841 ATCAAGGTCA AGTGAGGGGA ACAAGCGCAG CCAGTGATGA GTGCCCAACT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGACCA CGAACCCGAC GTCCAATGAT GACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t