Transcript: Human NM_012416.4

Homo sapiens RAN binding protein 6 (RANBP6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
RANBP6 (26953)
Length:
4600
CDS:
18..3335

Additional Resources:

NCBI RefSeq record:
NM_012416.4
NBCI Gene record:
RANBP6 (26953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012416.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420191 CATTCCGTCTTGGTGATTAAA pLKO_005 1509 CDS 100% 15.000 21.000 N RANBP6 n/a
2 TRCN0000414641 ATCGAGTGCATTAGCCATATT pLKO_005 1713 CDS 100% 13.200 18.480 N RANBP6 n/a
3 TRCN0000148942 CCAAGAATTGAGACAGGTGAA pLKO.1 2462 CDS 100% 4.050 5.670 N RANBP6 n/a
4 TRCN0000414144 TTTATGCAAGATGCATCAAAT pLKO_005 1758 CDS 100% 13.200 9.240 N RANBP6 n/a
5 TRCN0000146440 CCCTCACTAAAGCACATTGTT pLKO.1 1647 CDS 100% 5.625 3.938 N RANBP6 n/a
6 TRCN0000148875 CTCTGCAAGATGAGGATGAAT pLKO.1 2521 CDS 100% 5.625 3.938 N RANBP6 n/a
7 TRCN0000147280 GCTGATGAAATGGAAGAAGAT pLKO.1 1011 CDS 100% 4.950 3.465 N RANBP6 n/a
8 TRCN0000148876 CCTCGAAGTTATAGTGACCTT pLKO.1 878 CDS 100% 2.640 1.848 N RANBP6 n/a
9 TRCN0000149838 CCCTTGTTGAGATTGCAGATA pLKO.1 757 CDS 100% 4.950 2.970 N RANBP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012416.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02975 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02975 pLX_304 0% 100% 100% V5 n/a
Download CSV