Transcript: Human NM_012434.5

Homo sapiens solute carrier family 17 member 5 (SLC17A5), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC17A5 (26503)
Length:
3292
CDS:
107..1594

Additional Resources:

NCBI RefSeq record:
NM_012434.5
NBCI Gene record:
SLC17A5 (26503)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012434.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043623 GCCGTTGCTTTCCTAACTATA pLKO.1 1280 CDS 100% 13.200 18.480 N SLC17A5 n/a
2 TRCN0000300185 GCCGTTGCTTTCCTAACTATA pLKO_005 1280 CDS 100% 13.200 18.480 N SLC17A5 n/a
3 TRCN0000043624 GCTCGTTACAACTTAGCAATT pLKO.1 218 CDS 100% 10.800 15.120 N SLC17A5 n/a
4 TRCN0000300186 GCTCGTTACAACTTAGCAATT pLKO_005 218 CDS 100% 10.800 15.120 N SLC17A5 n/a
5 TRCN0000043627 CGTTAGTGGATATGGTAGATT pLKO.1 294 CDS 100% 5.625 7.875 N SLC17A5 n/a
6 TRCN0000310567 CGTTAGTGGATATGGTAGATT pLKO_005 294 CDS 100% 5.625 7.875 N SLC17A5 n/a
7 TRCN0000043625 GCTATCGTAGTTGCACACTTT pLKO.1 983 CDS 100% 4.950 3.465 N SLC17A5 n/a
8 TRCN0000300184 GCTATCGTAGTTGCACACTTT pLKO_005 983 CDS 100% 4.950 3.465 N SLC17A5 n/a
9 TRCN0000043626 GCTACTATATGAATTGGACTT pLKO.1 768 CDS 100% 4.050 2.835 N SLC17A5 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2374 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012434.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.