Transcript: Human NM_012476.3

Homo sapiens ventral anterior homeobox 2 (VAX2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
VAX2 (25806)
Length:
1161
CDS:
47..919

Additional Resources:

NCBI RefSeq record:
NM_012476.3
NBCI Gene record:
VAX2 (25806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012476.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422518 AGCGGACACGTACATCCTTCA pLKO_005 354 CDS 100% 4.050 5.670 N VAX2 n/a
2 TRCN0000016601 CGCCGCATACTGGTGCGAGAT pLKO.1 275 CDS 100% 0.000 0.000 N VAX2 n/a
3 TRCN0000016598 GCTGCAAGAAAGCTAACACTT pLKO.1 897 CDS 100% 4.950 3.465 N VAX2 n/a
4 TRCN0000016600 CCAAAGGGACAATTCGGGAAA pLKO.1 297 CDS 100% 4.050 2.835 N VAX2 n/a
5 TRCN0000016602 TCGGGAAATTGTCCTGCCTAA pLKO.1 310 CDS 100% 4.050 2.835 N VAX2 n/a
6 TRCN0000428834 CCTCTGCCAGCTGTCTGCTTT pLKO_005 776 CDS 100% 1.650 1.155 N VAX2 n/a
7 TRCN0000016599 CGCCGCACCAAGCAGAAGAAA pLKO.1 503 CDS 100% 1.875 1.125 N VAX2 n/a
8 TRCN0000240652 TCTGGTTCCAGAACCGCCGAA pLKO_005 489 CDS 100% 0.720 0.360 Y Nkx1-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012476.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02858 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02858 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467981 TCTAACTCTTCCACCTCCAGACAA pLX_317 38.6% 100% 100% V5 n/a
Download CSV