Construct: ORF TRCN0000467981
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013393.1_s317c1
- Derived from:
- ccsbBroadEn_02858
- DNA Barcode:
- TCTAACTCTTCCACCTCCAGACAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VAX2 (25806)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467981
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 25806 | VAX2 | ventral anterior homeobox 2 | NM_012476.3 | 100% | 100% | |
| 2 | human | 25806 | VAX2 | ventral anterior homeobox 2 | XM_006711982.4 | 51% | 50.6% | (many diffs) |
| 3 | human | 25806 | VAX2 | ventral anterior homeobox 2 | XM_011532750.3 | 51% | 50.6% | (many diffs) |
| 4 | human | 25806 | VAX2 | ventral anterior homeobox 2 | XM_011532751.3 | 51% | 50.6% | (many diffs) |
| 5 | mouse | 24113 | Vax2 | ventral anterior homeobox 2 | NM_011912.4 | 85.5% | 87.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 936
- ORF length:
- 870
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg cgatgggggc gccgagcgcg accggggccc cgcgcgccgg gcggagtctg 121 gtggcggcgg tgggcgctgc ggagaccgca gcggagcggg ggacttgcga gctgatggcg 181 gtggccacag cccaacggag gtggccggga cctcagcctc cagtcccgca ggctccaggg 241 agagtggagc cgacagcgac gggcagcccg ggcccggcga ggcagaccac tgccgccgca 301 tactggtgcg agatgccaaa gggacaattc gggaaattgt cctgcctaag ggcctggacc 361 tggaccggcc caagcggaca cgtacatcct tcactgccga gcagctgtac cgcctggaga 421 tggagttcca gcgctgccag tatgtggtgg gccgcgagcg cactgagctg gcccgccagc 481 tgaacctctc cgagacccag gtgaaggtct ggttccagaa ccgccgcacc aagcagaaga 541 aagaccagag cagagacctg gagaagcggg cgtcctcctc agcctccgag gcctttgcca 601 ccTCCAACAT TCTGCGGCTG CTGGAGCAGG GCCGGCTGCT CTCTGTGCCC AGGGCCCCTA 661 GCCTCCTGGC GCTGACCCCT AGCCTGCCAG GCCTACCTGC CAGCCACAGG GGCACCTCCT 721 TAGGTGACCC CAGGAACTCC TCCCCACGCC TCAACCCGCT GTCCTCGGCC TCAGCGTCCC 781 CCCCACTGCC GCCCCCTCTG CCAGCTGTCT GCTTTTCCTC GGCCCCGCTC CTGGATCTGC 841 CTGCCGGCTA CGAACTGGGT TCCTCGGCCT TCGAGCCATA CAGCTGGCTA GAACGGAAAG 901 TGGGCAGCGC CAGCAGCTGC AAGAAAGCTA ACACTTACCC AACTTTCTTG TACAAAGTGG 961 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1021 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1081 ATCTAACTCT TCCACCTCCA GACAAACGCG TTAAGTCgac aatcaacctc tggattacaa 1141 aatttgtgaa agatt