Transcript: Human NM_013300.3

Homo sapiens family with sequence similarity 216 member A (FAM216A), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM216A (29902)
Length:
1101
CDS:
32..853

Additional Resources:

NCBI RefSeq record:
NM_013300.3
NBCI Gene record:
FAM216A (29902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013300.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294243 GACAGTCTTGTCTCGTGTATT pLKO_005 852 CDS 100% 13.200 10.560 N FAM216A n/a
2 TRCN0000072535 AGGGAGAACATCTGATGTTAA pLKO.1 828 CDS 100% 13.200 9.240 N FAM216A n/a
3 TRCN0000286840 AGGGAGAACATCTGATGTTAA pLKO_005 828 CDS 100% 13.200 9.240 N FAM216A n/a
4 TRCN0000072533 CCTGTATGTTTAGGATGGTAT pLKO.1 915 3UTR 100% 4.950 3.465 N FAM216A n/a
5 TRCN0000072534 GATGTTAATGAAGAGGCAGTA pLKO.1 412 CDS 100% 4.050 2.835 N FAM216A n/a
6 TRCN0000286841 GATGTTAATGAAGAGGCAGTA pLKO_005 412 CDS 100% 4.050 2.835 N FAM216A n/a
7 TRCN0000294162 TCGTGCCAAAGGTGAGGGTAA pLKO_005 877 3UTR 100% 4.050 2.835 N FAM216A n/a
8 TRCN0000072536 TGGATACTCTTGTTACCAGAA pLKO.1 181 CDS 100% 4.050 2.835 N FAM216A n/a
9 TRCN0000072537 GATACTCTTGTTACCAGAATT pLKO.1 183 CDS 100% 0.000 0.000 N FAM216A n/a
10 TRCN0000290364 GATACTCTTGTTACCAGAATT pLKO_005 183 CDS 100% 0.000 0.000 N FAM216A n/a
11 TRCN0000294225 TAGCTAAGCTGCAAGAGTTAT pLKO_005 252 CDS 100% 13.200 7.920 N FAM216A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013300.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08133 pDONR223 100% 99.8% 100% None 762A>G n/a
2 ccsbBroad304_08133 pLX_304 0% 99.8% 100% V5 762A>G n/a
3 TRCN0000474514 GTCATTAATATCCTCTCTTTTACC pLX_317 46.6% 99.8% 100% V5 762A>G n/a
Download CSV