Transcript: Human NM_013306.5

Homo sapiens sorting nexin 15 (SNX15), transcript variant A, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SNX15 (29907)
Length:
1908
CDS:
100..1128

Additional Resources:

NCBI RefSeq record:
NM_013306.5
NBCI Gene record:
SNX15 (29907)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013306.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381774 CCTACCTCCTGGTCTTGTAAT pLKO_005 1201 3UTR 100% 13.200 6.600 Y SNX15 n/a
2 TRCN0000065103 CGCGCAGTTCATCTCAAAGAA pLKO.1 192 CDS 100% 5.625 2.813 Y SNX15 n/a
3 TRCN0000307130 CGCGCAGTTCATCTCAAAGAA pLKO_005 192 CDS 100% 5.625 2.813 Y SNX15 n/a
4 TRCN0000065106 CCAGGAAGGTGTGAAGAAGAA pLKO.1 1041 CDS 100% 4.950 2.475 Y SNX15 n/a
5 TRCN0000307138 CCAGGAAGGTGTGAAGAAGAA pLKO_005 1041 CDS 100% 4.950 2.475 Y SNX15 n/a
6 TRCN0000065107 CTTCGCTTCACTGTGCACATA pLKO.1 409 CDS 100% 4.950 2.475 Y SNX15 n/a
7 TRCN0000289764 CTTCGCTTCACTGTGCACATA pLKO_005 409 CDS 100% 4.950 2.475 Y SNX15 n/a
8 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 1559 3UTR 100% 4.950 2.475 Y LOC387873 n/a
9 TRCN0000381537 TCTCAACTCCCACCCTAACAG pLKO_005 1111 CDS 100% 4.950 2.475 Y SNX15 n/a
10 TRCN0000065104 GTACAAAGTAACCGCGCAGTT pLKO.1 180 CDS 100% 4.050 2.025 Y SNX15 n/a
11 TRCN0000289763 GTACAAAGTAACCGCGCAGTT pLKO_005 180 CDS 100% 4.050 2.025 Y SNX15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013306.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03101 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03101 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470975 TGTCTCCAACTTTACCCCAATATA pLX_317 52.9% 100% 100% V5 n/a
Download CSV