Transcript: Human NM_013333.3

Homo sapiens epsin 1 (EPN1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
EPN1 (29924)
Length:
2423
CDS:
343..1995

Additional Resources:

NCBI RefSeq record:
NM_013333.3
NBCI Gene record:
EPN1 (29924)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380329 CCCTTTCCCGTGGCATTAGAA pLKO_005 2212 3UTR 100% 5.625 7.875 N EPN1 n/a
2 TRCN0000380307 GACGCTGATGGAGTACCTCAT pLKO_005 576 CDS 100% 4.050 5.670 N EPN1 n/a
3 TRCN0000077912 CACTAATCCCTTCCTCCTATA pLKO.1 1974 CDS 100% 10.800 7.560 N EPN1 n/a
4 TRCN0000379960 TGATCTGGAAGCGGCTCAATG pLKO_005 518 CDS 100% 10.800 7.560 N EPN1 n/a
5 TRCN0000380193 ACTACTCAGAGGCGGAGATCA pLKO_005 389 CDS 100% 4.950 3.465 N EPN1 n/a
6 TRCN0000077909 CCCGACGAGTTCTCTGACTTT pLKO.1 1465 CDS 100% 4.950 3.465 N EPN1 n/a
7 TRCN0000222736 GTGTTGTGAGTGCATGTGAAA pLKO.1 2057 3UTR 100% 4.950 3.465 N EPN1 n/a
8 TRCN0000381003 GACCTCACCTACAACGTTGTC pLKO_005 475 CDS 100% 4.050 2.835 N EPN1 n/a
9 TRCN0000077911 GCGTCACGTTTACAAGGCCAT pLKO.1 555 CDS 100% 2.160 1.512 N EPN1 n/a
10 TRCN0000077910 GCTGATGGAGTACCTCATCAA pLKO.1 579 CDS 100% 0.495 0.347 N EPN1 n/a
11 TRCN0000380062 AGCAGTGCAAGGAGAACATGT pLKO_005 623 CDS 100% 4.950 2.970 N EPN1 n/a
12 TRCN0000381224 AGTGTTGTGAGTGCATGTGAA pLKO_005 2056 3UTR 100% 4.950 2.970 N EPN1 n/a
13 TRCN0000381848 TGGACCTTGCTGACGTCTTCA pLKO_005 1040 CDS 100% 4.950 2.970 N EPN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03105 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03105 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475073 CTGGTATTAACACCGTTGCAGGCC pLX_317 25.8% 100% 100% V5 n/a
Download CSV