Transcript: Human NM_013385.5

Homo sapiens cytohesin 4 (CYTH4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CYTH4 (27128)
Length:
3077
CDS:
63..1247

Additional Resources:

NCBI RefSeq record:
NM_013385.5
NBCI Gene record:
CYTH4 (27128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013385.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242587 CCGCCAAGGGTATCCAGTATT pLKO_005 289 CDS 100% 13.200 18.480 N CYTH4 n/a
2 TRCN0000242586 TTGCACGGTTCCTGTATAAAG pLKO_005 349 CDS 100% 13.200 18.480 N CYTH4 n/a
3 TRCN0000242588 CAAGCAGGATGGGTGCTATAT pLKO_005 2138 3UTR 100% 13.200 9.240 N CYTH4 n/a
4 TRCN0000242589 TGCCAGCAAGCAGTGAGATTC pLKO_005 1232 CDS 100% 10.800 7.560 N CYTH4 n/a
5 TRCN0000180673 GAAGCCAAGAAGGGAGAGTTT pLKO.1 2163 3UTR 100% 4.950 3.465 N CYTH4 n/a
6 TRCN0000180672 GCCACAGACATCATTGCTGTT pLKO.1 1343 3UTR 100% 4.050 2.835 N CYTH4 n/a
7 TRCN0000242590 TGCAGATGTGTTTGCCCAAAT pLKO_005 182 CDS 100% 10.800 6.480 N CYTH4 n/a
8 TRCN0000379615 TGCAGATGTGTTTGCCCAAAT pLKO_005 182 CDS 100% 10.800 6.480 N Cyth4 n/a
9 TRCN0000381367 ACCTCACTCACACCTTCTTTA pLKO_005 817 CDS 100% 13.200 7.920 N Cyth4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013385.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11846 pDONR223 100% 29.9% 29.9% None 355_1182del n/a
2 ccsbBroad304_11846 pLX_304 0% 29.9% 29.9% V5 355_1182del n/a
3 TRCN0000478838 GGCCGAAATTAGCAACATAGGGCT pLX_317 95.7% 29.9% 29.9% V5 355_1182del n/a
Download CSV