Transcript: Human NM_013397.6

Homo sapiens prickle planar cell polarity protein 4 (PRICKLE4), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
PRICKLE4 (29964)
Length:
1706
CDS:
229..1383

Additional Resources:

NCBI RefSeq record:
NM_013397.6
NBCI Gene record:
PRICKLE4 (29964)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013397.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426538 TTCAGTACTGCGCGTTCTAAG pLKO_005 1536 3UTR 100% 10.800 15.120 N PRICKLE4 n/a
2 TRCN0000431132 AGGACAGCAACGCCTCTAAGA pLKO_005 1343 CDS 100% 4.950 6.930 N PRICKLE4 n/a
3 TRCN0000418275 CAATGCCGCCTGGAGACTATT pLKO_005 1201 CDS 100% 13.200 10.560 N PRICKLE4 n/a
4 TRCN0000116354 GACTCGGAACCTGAAGGATTT pLKO.1 1267 CDS 100% 10.800 7.560 N PRICKLE4 n/a
5 TRCN0000116353 CCTGATAAACCTCATCTACTT pLKO.1 714 CDS 100% 4.950 3.465 N PRICKLE4 n/a
6 TRCN0000423072 GCTTGTGACCAGCTGATCTTC pLKO_005 799 CDS 100% 4.950 3.465 N PRICKLE4 n/a
7 TRCN0000116355 TGAAGGACACACCTGTGAGAA pLKO.1 585 CDS 100% 4.950 3.465 N PRICKLE4 n/a
8 TRCN0000116356 CGAACTGAAGGAAGGGACCAA pLKO.1 1033 CDS 100% 2.640 1.848 N PRICKLE4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013397.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11914 pDONR223 100% 88.6% 88.5% None 1_124del;127_128insTCTC;861_862insCTT n/a
2 ccsbBroad304_11914 pLX_304 0% 88.6% 88.5% V5 1_124del;127_128insTCTC;861_862insCTT n/a
3 TRCN0000481227 GAGTAGGTAGTCAGTGATGATAAT pLX_317 38% 88.6% 88.5% V5 1_124del;127_128insTCTC;861_862insCTT n/a
Download CSV