Transcript: Human NM_013402.7

Homo sapiens fatty acid desaturase 1 (FADS1), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
FADS1 (3992)
Length:
4364
CDS:
75..1580

Additional Resources:

NCBI RefSeq record:
NM_013402.7
NBCI Gene record:
FADS1 (3992)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013402.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064706 GTCCGCTTCTTCCTCACTTAT pLKO.1 1155 CDS 100% 13.200 9.240 N FADS1 n/a
2 TRCN0000292143 GTCCGCTTCTTCCTCACTTAT pLKO_005 1155 CDS 100% 13.200 9.240 N FADS1 n/a
3 TRCN0000064704 CCTTGTGAAGAAGTATATGAA pLKO.1 482 CDS 100% 5.625 3.938 N FADS1 n/a
4 TRCN0000292145 CCTTGTGAAGAAGTATATGAA pLKO_005 482 CDS 100% 5.625 3.938 N FADS1 n/a
5 TRCN0000064703 CCTCGACACAATTACCACAAA pLKO.1 1419 CDS 100% 4.950 3.465 N FADS1 n/a
6 TRCN0000292083 CCTCGACACAATTACCACAAA pLKO_005 1419 CDS 100% 4.950 3.465 N FADS1 n/a
7 TRCN0000064705 CCGACATCATCCACTCACTAA pLKO.1 1516 CDS 100% 4.950 2.970 N FADS1 n/a
8 TRCN0000292084 CCGACATCATCCACTCACTAA pLKO_005 1516 CDS 100% 4.950 2.970 N FADS1 n/a
9 TRCN0000064707 GCATCCCTTCTTCTTTGCCTT pLKO.1 947 CDS 100% 2.640 1.584 N FADS1 n/a
10 TRCN0000292086 GCATCCCTTCTTCTTTGCCTT pLKO_005 947 CDS 100% 2.640 1.584 N FADS1 n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1997 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013402.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10948 pDONR223 100% 88.5% 88.4% None 1_171del;985C>T n/a
2 ccsbBroad304_10948 pLX_304 0% 88.5% 88.4% V5 1_171del;985C>T n/a
3 TRCN0000468135 AATTATATACCGAAGTCCCTCCCG pLX_317 28.1% 88.5% 88.4% V5 1_171del;985C>T n/a
Download CSV