Transcript: Mouse NM_013415.5

Mus musculus ATPase, Na+/K+ transporting, beta 2 polypeptide (Atp1b2), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Atp1b2 (11932)
Length:
2959
CDS:
589..1461

Additional Resources:

NCBI RefSeq record:
NM_013415.5
NBCI Gene record:
Atp1b2 (11932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013415.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112870 CCACACAATTTCCAACATCTT pLKO.1 1626 3UTR 100% 4.950 3.960 N Atp1b2 n/a
2 TRCN0000112871 CGATATTATGAGCAACCTGAT pLKO.1 985 CDS 100% 4.050 3.240 N Atp1b2 n/a
3 TRCN0000112873 CTGATGTACTTTCCCTACTAT pLKO.1 1261 CDS 100% 5.625 3.938 N Atp1b2 n/a
4 TRCN0000112872 CCCAAGACTGAGAACCTTGAT pLKO.1 844 CDS 100% 4.950 3.465 N Atp1b2 n/a
5 TRCN0000112874 TCTGATGTACTTTCCCTACTA pLKO.1 1260 CDS 100% 4.950 3.465 N Atp1b2 n/a
6 TRCN0000147368 GAACCTTGATGTCATTGTCAA pLKO.1 855 CDS 100% 4.950 2.970 N ATP1B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013415.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00123 pDONR223 100% 90.9% 97.2% None (many diffs) n/a
2 ccsbBroad304_00123 pLX_304 0% 90.9% 97.2% V5 (many diffs) n/a
3 TRCN0000465645 ATATGAATTGTTTCGATTTCCCGC pLX_317 35.8% 90.9% 97.2% V5 (many diffs) n/a
Download CSV