Transcript: Mouse NM_013467.3

Mus musculus aldehyde dehydrogenase family 1, subfamily A1 (Aldh1a1), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Aldh1a1 (11668)
Length:
2032
CDS:
31..1536

Additional Resources:

NCBI RefSeq record:
NM_013467.3
NBCI Gene record:
Aldh1a1 (11668)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042050 CGGATTTAGGAGGCTGCATAA pLKO.1 392 CDS 100% 10.800 15.120 N Aldh1a1 n/a
2 TRCN0000308500 CGGATTTAGGAGGCTGCATAA pLKO_005 392 CDS 100% 10.800 15.120 N Aldh1a1 n/a
3 TRCN0000042049 CGAGCTAAGAAATATGTTCTT pLKO.1 1006 CDS 100% 0.495 0.396 N Aldh1a1 n/a
4 TRCN0000042052 CGCAATGAAGATATCTCAGAA pLKO.1 1506 CDS 100% 4.950 3.465 N Aldh1a1 n/a
5 TRCN0000308586 CGCAATGAAGATATCTCAGAA pLKO_005 1506 CDS 100% 4.950 3.465 N Aldh1a1 n/a
6 TRCN0000042051 GCTCATGTTCATTTGGAAGAT pLKO.1 549 CDS 100% 4.950 3.465 N Aldh1a1 n/a
7 TRCN0000308502 GCTCATGTTCATTTGGAAGAT pLKO_005 549 CDS 100% 4.950 3.465 N Aldh1a1 n/a
8 TRCN0000042048 CCCAGTTCTTATCCAAGAATA pLKO.1 1728 3UTR 100% 1.320 0.924 N Aldh1a1 n/a
9 TRCN0000308588 CCCAGTTCTTATCCAAGAATA pLKO_005 1728 3UTR 100% 1.320 0.924 N Aldh1a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00048 pDONR223 100% 84.5% 87% None (many diffs) n/a
2 ccsbBroad304_00048 pLX_304 0% 84.5% 87% V5 (many diffs) n/a
3 TRCN0000479155 CTTTTATCGGACCTTAAACTAACT pLX_317 29.2% 84.5% 87% V5 (many diffs) n/a
Download CSV