Transcript: Mouse NM_013472.5

Mus musculus annexin A6 (Anxa6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Anxa6 (11749)
Length:
2670
CDS:
140..2161

Additional Resources:

NCBI RefSeq record:
NM_013472.5
NBCI Gene record:
Anxa6 (11749)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013472.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008687 GCCTATCAGATGTGGGAACTT pLKO.1 1154 CDS 100% 4.950 6.930 N ANXA6 n/a
2 TRCN0000381348 CGATGTTGTGAGCGAGGATTT pLKO_005 646 CDS 100% 10.800 8.640 N Anxa6 n/a
3 TRCN0000110652 CGACTGGTGTTTGATGAGTAT pLKO.1 773 CDS 100% 4.950 3.960 N Anxa6 n/a
4 TRCN0000317111 CGACTGGTGTTTGATGAGTAT pLKO_005 773 CDS 100% 4.950 3.960 N Anxa6 n/a
5 TRCN0000110651 CCTCTCTTCTTTGCTGATAAA pLKO.1 1940 CDS 100% 13.200 9.240 N Anxa6 n/a
6 TRCN0000317113 CCTCTCTTCTTTGCTGATAAA pLKO_005 1940 CDS 100% 13.200 9.240 N Anxa6 n/a
7 TRCN0000380948 TGTGTGTGCAGCCAATGATTT pLKO_005 1207 CDS 100% 13.200 9.240 N Anxa6 n/a
8 TRCN0000110650 TGCTCCAGCTTCAGGATCTAA pLKO.1 2240 3UTR 100% 5.625 3.938 N Anxa6 n/a
9 TRCN0000317114 TGCTCCAGCTTCAGGATCTAA pLKO_005 2240 3UTR 100% 5.625 3.938 N Anxa6 n/a
10 TRCN0000110654 CAGAATTACAAGTCCCTGTAT pLKO.1 317 CDS 100% 4.950 3.465 N Anxa6 n/a
11 TRCN0000110653 GCAGACCTTCAAATCTCACTT pLKO.1 1345 CDS 100% 4.950 3.465 N Anxa6 n/a
12 TRCN0000317112 GCAGACCTTCAAATCTCACTT pLKO_005 1345 CDS 100% 4.950 3.465 N Anxa6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013472.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00071 pDONR223 100% 89.4% 94.3% None (many diffs) n/a
2 ccsbBroad304_00071 pLX_304 0% 89.4% 94.3% V5 (many diffs) n/a
3 TRCN0000479967 AAAGAGGCTTCGGTGCACCTTGCG pLX_317 17.4% 89.4% 94.3% V5 (many diffs) n/a
Download CSV