Transcript: Mouse NM_013502.3

Mus musculus C-terminal binding protein 1 (Ctbp1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Ctbp1 (13016)
Length:
2305
CDS:
187..1512

Additional Resources:

NCBI RefSeq record:
NM_013502.3
NBCI Gene record:
Ctbp1 (13016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085773 GCTAATTCTATCACGAATGTT pLKO.1 1748 3UTR 100% 5.625 7.875 N Ctbp1 n/a
2 TRCN0000085774 CGGGTTTGACAATATCGACAT pLKO.1 486 CDS 100% 4.050 5.670 N Ctbp1 n/a
3 TRCN0000085776 GCTCTTAGAATCATCGTCCGA pLKO.1 457 CDS 100% 0.660 0.924 N Ctbp1 n/a
4 TRCN0000085777 CCATACGAGTGACCAGTTGTA pLKO.1 1491 CDS 100% 4.950 3.960 N Ctbp1 n/a
5 TRCN0000085775 CGTCCTCTTCTATGATCCATA pLKO.1 783 CDS 100% 4.950 3.960 N Ctbp1 n/a
6 TRCN0000435427 AGAAGATCTGGAGAAGTTTAA pLKO_005 435 CDS 100% 13.200 9.240 N Ctbp1 n/a
7 TRCN0000435390 TCCTTTGCGTTCCTCGTTTAA pLKO_005 1711 3UTR 100% 13.200 9.240 N Ctbp1 n/a
8 TRCN0000412353 GAGAGACCTTGGGCATCATTG pLKO_005 707 CDS 100% 10.800 7.560 N Ctbp1 n/a
9 TRCN0000433738 ACCACCTCATCAATGACTTTA pLKO_005 917 CDS 100% 13.200 7.920 N Ctbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00389 pDONR223 100% 85.6% 95.6% None (many diffs) n/a
2 ccsbBroad304_00389 pLX_304 0% 85.6% 95.6% V5 (many diffs) n/a
3 TRCN0000474981 CGCGTGTTGCTTGACGGCCTAACC pLX_317 16.5% 85.6% 95.6% V5 (many diffs) n/a
Download CSV