Transcript: Mouse NM_013515.2

Mus musculus stomatin (Stom), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Stom (13830)
Length:
2816
CDS:
91..945

Additional Resources:

NCBI RefSeq record:
NM_013515.2
NBCI Gene record:
Stom (13830)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112911 CGTAATTATAACCTTCCCAAT pLKO.1 213 CDS 100% 4.050 5.670 N Stom n/a
2 TRCN0000302744 CGTAATTATAACCTTCCCAAT pLKO_005 213 CDS 100% 4.050 5.670 N Stom n/a
3 TRCN0000112914 GAGGACCATCTCCTTTGACAT pLKO.1 378 CDS 100% 4.950 3.465 N Stom n/a
4 TRCN0000315534 GAGGACCATCTCCTTTGACAT pLKO_005 378 CDS 100% 4.950 3.465 N Stom n/a
5 TRCN0000112912 GCTGTGGCCAATATCACCAAT pLKO.1 484 CDS 100% 4.950 3.465 N Stom n/a
6 TRCN0000302817 GCTGTGGCCAATATCACCAAT pLKO_005 484 CDS 100% 4.950 3.465 N Stom n/a
7 TRCN0000112910 GCTTGTAAATAACGAGAGAAT pLKO.1 1216 3UTR 100% 4.950 3.465 N Stom n/a
8 TRCN0000302818 GCTTGTAAATAACGAGAGAAT pLKO_005 1216 3UTR 100% 4.950 3.465 N Stom n/a
9 TRCN0000112913 CAGGGCATCATGGGTTCTAAT pLKO.1 919 CDS 100% 13.200 6.600 Y Stom n/a
10 TRCN0000302745 CAGGGCATCATGGGTTCTAAT pLKO_005 919 CDS 100% 13.200 6.600 Y Stom n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06166 pDONR223 100% 81.4% 85.7% None (many diffs) n/a
2 ccsbBroad304_06166 pLX_304 0% 81.4% 85.7% V5 (many diffs) n/a
3 TRCN0000479857 ACCATACGAGCTATAAAGGCACCT pLX_317 43.8% 81.4% 85.7% V5 (many diffs) n/a
Download CSV