Transcript: Mouse NM_013609.3

Mus musculus nerve growth factor (Ngf), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ngf (18049)
Length:
1196
CDS:
108..1031

Additional Resources:

NCBI RefSeq record:
NM_013609.3
NBCI Gene record:
Ngf (18049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013609.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339314 AGTGAGGTGCATAGCGTAATG pLKO_005 288 CDS 100% 10.800 15.120 N Ngf n/a
2 TRCN0000068128 GCATAGCGTAATGTCCATGTT pLKO.1 296 CDS 100% 4.950 6.930 N Ngf n/a
3 TRCN0000339243 TCAGTGTCTGGGCCCAATAAA pLKO_005 231 CDS 100% 15.000 10.500 N Ngf n/a
4 TRCN0000375353 CAGTGTGTGGGTTGGAGATAA pLKO_005 722 CDS 100% 13.200 9.240 N Ngf n/a
5 TRCN0000339242 CCAAGGACGCAGCTTTCTATA pLKO_005 259 CDS 100% 13.200 9.240 N Ngf n/a
6 TRCN0000351084 CCTGAAGCCCACTGGACTAAA pLKO_005 402 CDS 100% 13.200 9.240 N Ngf n/a
7 TRCN0000058404 ACTGGACTAAACTTCAGCATT pLKO.1 412 CDS 100% 4.950 3.465 N NGF n/a
8 TRCN0000068132 CAGTGTATTCAGACAGTACTT pLKO.1 806 CDS 100% 4.950 3.465 N Ngf n/a
9 TRCN0000068129 CTCCAAACACTGGAACTCATA pLKO.1 884 CDS 100% 4.950 3.465 N Ngf n/a
10 TRCN0000379142 GAACCGTACACAGATAGCAAT pLKO_005 360 CDS 100% 4.950 3.465 N Ngf n/a
11 TRCN0000068130 CACTGGACTAAACTTCAGCAT pLKO.1 411 CDS 100% 2.640 1.848 N Ngf n/a
12 TRCN0000068131 CCAGACTGTTTAAGAAACGGA pLKO.1 526 CDS 100% 0.750 0.525 N Ngf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013609.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06640 pDONR223 100% 66.8% 66.4% None (many diffs) n/a
2 ccsbBroad304_06640 pLX_304 0% 66.8% 66.4% V5 (many diffs) n/a
3 TRCN0000468216 AGCCTCCGCCTCAAGGCTGACCAC pLX_317 56.1% 66.8% 66.4% V5 (many diffs) n/a
Download CSV