Transcript: Mouse NM_013712.2

Mus musculus integrin beta 1 binding protein 2 (Itgb1bp2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Itgb1bp2 (26549)
Length:
1316
CDS:
65..1117

Additional Resources:

NCBI RefSeq record:
NM_013712.2
NBCI Gene record:
Itgb1bp2 (26549)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248574 TAGTAGTGCTGACGGTCTATG pLKO_005 750 CDS 100% 10.800 15.120 N Itgb1bp2 n/a
2 TRCN0000180844 GCCGAAAGCGAACTGTAGATT pLKO.1 192 CDS 100% 5.625 7.875 N ITGB1BP2 n/a
3 TRCN0000184152 CCCTGATTCACTAGCTGAGAA pLKO.1 982 CDS 100% 4.950 6.930 N Itgb1bp2 n/a
4 TRCN0000248573 CGGGAGCAGGACTTGACAATA pLKO_005 468 CDS 100% 13.200 10.560 N Itgb1bp2 n/a
5 TRCN0000215773 CAAACTGCTACCACTTCTTAT pLKO.1 397 CDS 100% 13.200 9.240 N Itgb1bp2 n/a
6 TRCN0000248572 CAAACTGCTACCACTTCTTAT pLKO_005 397 CDS 100% 13.200 9.240 N Itgb1bp2 n/a
7 TRCN0000195744 CCCAGGATGTGATGCTGTTTA pLKO.1 520 CDS 100% 13.200 9.240 N Itgb1bp2 n/a
8 TRCN0000148342 CCGAAAGCGAACTGTAGATTT pLKO.1 193 CDS 100% 13.200 9.240 N ITGB1BP2 n/a
9 TRCN0000248571 AGAGACCTTGTTCCGAGAAAG pLKO_005 355 CDS 100% 10.800 7.560 N Itgb1bp2 n/a
10 TRCN0000248575 TAACAGCAGACAGTTGAGTTT pLKO_005 1118 CDS 100% 4.950 3.465 N Itgb1bp2 n/a
11 TRCN0000092881 GAGGAAGATGAAGAGGAGGAA pLKO.1 1079 CDS 100% 2.640 1.320 Y Gm4169 n/a
12 TRCN0000413410 AGGAGGAAGATGAAGAGGAAG pLKO_005 1077 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013712.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11831 pDONR223 100% 85.6% 86.6% None (many diffs) n/a
2 ccsbBroad304_11831 pLX_304 0% 85.6% 86.6% V5 (many diffs) n/a
3 TRCN0000475403 TGATAGCGCTCTGCCTGGGTCAAC pLX_317 17.1% 85.6% 86.6% V5 (many diffs) n/a
Download CSV