Transcript: Mouse NM_013758.4

Mus musculus adducin 3 (gamma) (Add3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Add3 (27360)
Length:
4261
CDS:
105..2225

Additional Resources:

NCBI RefSeq record:
NM_013758.4
NBCI Gene record:
Add3 (27360)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108735 CGAGTCGTATTTGAACCATAT pLKO.1 3072 3UTR 100% 10.800 15.120 N Add3 n/a
2 TRCN0000303072 CGAGTCGTATTTGAACCATAT pLKO_005 3072 3UTR 100% 10.800 15.120 N Add3 n/a
3 TRCN0000108736 CGGGAACAGAATCGCTATGAT pLKO.1 1629 CDS 100% 5.625 7.875 N Add3 n/a
4 TRCN0000303075 CGGGAACAGAATCGCTATGAT pLKO_005 1629 CDS 100% 5.625 7.875 N Add3 n/a
5 TRCN0000108738 CCTCGTATGTGAAGGGAGAAA pLKO.1 487 CDS 100% 4.950 6.930 N Add3 n/a
6 TRCN0000302999 CCTCGTATGTGAAGGGAGAAA pLKO_005 487 CDS 100% 4.950 6.930 N Add3 n/a
7 TRCN0000108737 GCTGCATCTGTTTCACAAATT pLKO.1 1866 CDS 100% 13.200 9.240 N Add3 n/a
8 TRCN0000303073 GCTGCATCTGTTTCACAAATT pLKO_005 1866 CDS 100% 13.200 9.240 N Add3 n/a
9 TRCN0000108739 TCCTCGTATGTGAAGGGAGAA pLKO.1 486 CDS 100% 4.050 2.835 N Add3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00026 pDONR223 100% 87% 92.2% None (many diffs) n/a
Download CSV