Transcript: Mouse NM_013854.1

Mus musculus ATP-binding cassette, sub-family F (GCN20), member 1 (Abcf1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Abcf1 (224742)
Length:
3207
CDS:
33..2546

Additional Resources:

NCBI RefSeq record:
NM_013854.1
NBCI Gene record:
Abcf1 (224742)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113402 CGCGGACAAAGTAGTGAAGAA pLKO.1 101 CDS 100% 4.950 6.930 N Abcf1 n/a
2 TRCN0000326270 CGCGGACAAAGTAGTGAAGAA pLKO_005 101 CDS 100% 4.950 6.930 N Abcf1 n/a
3 TRCN0000113404 GCATCTGACATTAAGTTGGAA pLKO.1 909 CDS 100% 3.000 4.200 N Abcf1 n/a
4 TRCN0000326271 GCATCTGACATTAAGTTGGAA pLKO_005 909 CDS 100% 3.000 4.200 N Abcf1 n/a
5 TRCN0000113401 CCAACCAATAACTTGGACATA pLKO.1 2313 CDS 100% 4.950 3.465 N Abcf1 n/a
6 TRCN0000326326 CCAACCAATAACTTGGACATA pLKO_005 2313 CDS 100% 4.950 3.465 N Abcf1 n/a
7 TRCN0000113403 CGGCGACTTTGATGACTACAA pLKO.1 2471 CDS 100% 4.950 3.465 N Abcf1 n/a
8 TRCN0000326268 CGGCGACTTTGATGACTACAA pLKO_005 2471 CDS 100% 4.950 3.465 N Abcf1 n/a
9 TRCN0000113400 GCCTCTTGTCTCAAGACCTTT pLKO.1 2901 3UTR 100% 4.950 3.465 N Abcf1 n/a
10 TRCN0000326269 GCCTCTTGTCTCAAGACCTTT pLKO_005 2901 3UTR 100% 4.950 3.465 N Abcf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.