Transcript: Mouse NM_013867.2

Mus musculus breast cancer anti-estrogen resistance 3 (Bcar3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Bcar3 (29815)
Length:
3316
CDS:
416..2878

Additional Resources:

NCBI RefSeq record:
NM_013867.2
NBCI Gene record:
Bcar3 (29815)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249863 GCCTATCAAGACGTGTCTATA pLKO_005 536 CDS 100% 13.200 18.480 N Bcar3 n/a
2 TRCN0000177391 GCCTGTCAACTCTAAGTAATA pLKO.1 2923 3UTR 100% 13.200 18.480 N Bcar3 n/a
3 TRCN0000249865 TAACATCCACAGGATAGTAAA pLKO_005 2973 3UTR 100% 13.200 18.480 N Bcar3 n/a
4 TRCN0000198663 CCAATTCGAGATGGAGAGCTT pLKO.1 1048 CDS 100% 2.640 3.696 N Bcar3 n/a
5 TRCN0000257954 GGGTTGGAGCTCATTACTTTA pLKO_005 2144 CDS 100% 13.200 9.240 N Bcar3 n/a
6 TRCN0000249862 GTCAACCAGAACGAGAGATAC pLKO_005 2783 CDS 100% 10.800 7.560 N Bcar3 n/a
7 TRCN0000178066 GCAGATTTCCAACCAGATGAA pLKO.1 2696 CDS 100% 4.950 3.465 N Bcar3 n/a
8 TRCN0000249864 TGGTGTCTGGAGGAGCGTTAT pLKO_005 1175 CDS 100% 10.800 6.480 N Bcar3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01924 pDONR223 100% 84.3% 85.3% None (many diffs) n/a
2 ccsbBroad304_01924 pLX_304 0% 84.3% 85.3% V5 (many diffs) n/a
3 TRCN0000468731 TGCGAACAGACTGACTAACACAGG pLX_317 16.5% 84.3% 85.3% V5 (many diffs) n/a
Download CSV