Transcript: Mouse NM_013876.3

Mus musculus ring finger protein 11 (Rnf11), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rnf11 (29864)
Length:
2132
CDS:
274..738

Additional Resources:

NCBI RefSeq record:
NM_013876.3
NBCI Gene record:
Rnf11 (29864)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038795 CCGCCATATCAGGAACAAGTT pLKO.1 385 CDS 100% 4.950 6.930 N RNF11 n/a
2 TRCN0000332925 CCGCCATATCAGGAACAAGTT pLKO_005 385 CDS 100% 4.950 6.930 N RNF11 n/a
3 TRCN0000238170 ACCTGTTGTAAGTGCTATATT pLKO_005 1334 3UTR 100% 15.000 10.500 N Rnf11 n/a
4 TRCN0000238167 CATCTGCCTAAAGGAGTTTAT pLKO_005 508 CDS 100% 13.200 9.240 N Rnf11 n/a
5 TRCN0000238171 CTGTATGATGGACTTTGTTTA pLKO_005 576 CDS 100% 13.200 9.240 N Rnf11 n/a
6 TRCN0000041099 CTTTCATCCTATGAGACTAAT pLKO.1 715 CDS 100% 13.200 9.240 N Rnf11 n/a
7 TRCN0000041098 GCTCAAAGAATAGGCCTTATA pLKO.1 484 CDS 100% 13.200 9.240 N Rnf11 n/a
8 TRCN0000238168 GCTGACTGAAGAGGAACAAAT pLKO_005 456 CDS 100% 13.200 9.240 N Rnf11 n/a
9 TRCN0000238169 TGCCGTGCATGCACATCTATC pLKO_005 617 CDS 100% 10.800 7.560 N Rnf11 n/a
10 TRCN0000041102 CTGTATAGATGACTGGTTGAT pLKO.1 645 CDS 100% 4.950 3.465 N Rnf11 n/a
11 TRCN0000038797 GCTTTCATCCTATGAGACTAA pLKO.1 714 CDS 100% 4.950 3.465 N RNF11 n/a
12 TRCN0000363724 GCTTTCATCCTATGAGACTAA pLKO_005 714 CDS 100% 4.950 3.465 N RNF11 n/a
13 TRCN0000038798 GTGATCTGTATGATGGACTTT pLKO.1 571 CDS 100% 4.950 3.465 N RNF11 n/a
14 TRCN0000332990 GTGATCTGTATGATGGACTTT pLKO_005 571 CDS 100% 4.950 3.465 N RNF11 n/a
15 TRCN0000041100 CCATCTATCATCCGACACCTA pLKO.1 413 CDS 100% 2.640 1.848 N Rnf11 n/a
16 TRCN0000041101 GCCTTATACAGCATCTGCCTA pLKO.1 497 CDS 100% 2.640 1.848 N Rnf11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02979 pDONR223 100% 96.9% 99.3% None (many diffs) n/a
2 ccsbBroad304_02979 pLX_304 0% 96.9% 99.3% V5 (many diffs) n/a
3 TRCN0000467467 ATACCATCTTCGGATTCATGTACG pLX_317 94.3% 96.9% 99.3% V5 (many diffs) n/a
Download CSV