Transcript: Mouse NM_013879.2

Mus musculus calcium binding protein 1 (Cabp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Cabp1 (29867)
Length:
1181
CDS:
66..749

Additional Resources:

NCBI RefSeq record:
NM_013879.2
NBCI Gene record:
Cabp1 (29867)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313844 TGGAACTGATGGGCCCTAAAC pLKO_005 496 CDS 100% 10.800 15.120 N Cabp1 n/a
2 TRCN0000071824 CCGGGACATAGAGGAAATTAT pLKO.1 659 CDS 100% 15.000 10.500 N Cabp1 n/a
3 TRCN0000071826 AGAACAGACAACCTGACAGAT pLKO.1 277 CDS 100% 4.950 3.465 N Cabp1 n/a
4 TRCN0000317360 AGAACAGACAACCTGACAGAT pLKO_005 277 CDS 100% 4.950 3.465 N Cabp1 n/a
5 TRCN0000071823 CCGAGAATTTGACAAAGACAA pLKO.1 338 CDS 100% 4.950 3.465 N Cabp1 n/a
6 TRCN0000071827 GTCTCAGCAGATCAACATGAA pLKO.1 443 CDS 100% 4.950 3.465 N Cabp1 n/a
7 TRCN0000317425 GTCTCAGCAGATCAACATGAA pLKO_005 443 CDS 100% 4.950 3.465 N Cabp1 n/a
8 TRCN0000071825 ACGGCAGATATGATTGGTGTA pLKO.1 528 CDS 100% 4.050 2.835 N Cabp1 n/a
9 TRCN0000317361 ACGGCAGATATGATTGGTGTA pLKO_005 528 CDS 100% 4.050 2.835 N Cabp1 n/a
10 TRCN0000313776 TCCGCACTGTGAAAGACTCAC pLKO_005 909 3UTR 100% 4.050 2.835 N Cabp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11372 pDONR223 100% 64.3% 68.4% None (many diffs) n/a
2 ccsbBroad304_11372 pLX_304 0% 64.3% 68.4% V5 (many diffs) n/a
3 TRCN0000467078 GTACCATCTACACTATCAATTAAC pLX_317 44.3% 64.3% 68.4% V5 (many diffs) n/a
Download CSV