Transcript: Human NM_014018.3

Homo sapiens mitochondrial ribosomal protein S28 (MRPS28), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
MRPS28 (28957)
Length:
838
CDS:
12..575

Additional Resources:

NCBI RefSeq record:
NM_014018.3
NBCI Gene record:
MRPS28 (28957)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014018.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072614 GTGGAGAATGATCTGTACATA pLKO.1 333 CDS 100% 5.625 3.938 N MRPS28 n/a
2 TRCN0000072613 CGGCTATTAGATCTTGAACTT pLKO.1 438 CDS 100% 4.950 3.465 N MRPS28 n/a
3 TRCN0000291932 CGGCTATTAGATCTTGAACTT pLKO_005 438 CDS 100% 4.950 3.465 N MRPS28 n/a
4 TRCN0000072617 GCAACAACAGATACAACTGTA pLKO.1 477 CDS 100% 4.950 3.465 N MRPS28 n/a
5 TRCN0000291931 GCAACAACAGATACAACTGTA pLKO_005 477 CDS 100% 4.950 3.465 N MRPS28 n/a
6 TRCN0000072616 TGCTGAGACATTCTCCTCTTA pLKO.1 259 CDS 100% 4.950 3.465 N MRPS28 n/a
7 TRCN0000291930 TGCTGAGACATTCTCCTCTTA pLKO_005 259 CDS 100% 4.950 3.465 N MRPS28 n/a
8 TRCN0000072615 ACTGGTCATTGGACGGATCTT pLKO.1 305 CDS 100% 4.950 2.970 N MRPS28 n/a
9 TRCN0000291950 ACTGGTCATTGGACGGATCTT pLKO_005 305 CDS 100% 4.950 2.970 N MRPS28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014018.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.