Transcript: Human NM_014078.6

Homo sapiens mitochondrial ribosomal protein L13 (MRPL13), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MRPL13 (28998)
Length:
1260
CDS:
57..593

Additional Resources:

NCBI RefSeq record:
NM_014078.6
NBCI Gene record:
MRPL13 (28998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014078.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117399 GCTAGAATATGGTATCTCTTA pLKO.1 99 CDS 100% 4.950 6.930 N MRPL13 n/a
2 TRCN0000424673 ATACCTAAACGTCTAGATGAG pLKO_005 507 CDS 100% 4.050 5.670 N MRPL13 n/a
3 TRCN0000117398 CCACCTGAAGATTATCGGCTA pLKO.1 570 CDS 100% 2.160 3.024 N MRPL13 n/a
4 TRCN0000117397 GCTACAGTTCAGCACCTGTTT pLKO.1 683 3UTR 100% 4.950 3.960 N MRPL13 n/a
5 TRCN0000434276 TGAGGGATCCAGTGGCAATTG pLKO_005 346 CDS 100% 10.800 7.560 N MRPL13 n/a
6 TRCN0000117400 CAGGTGGATTTAGACAAGTAA pLKO.1 307 CDS 100% 5.625 3.938 N MRPL13 n/a
7 TRCN0000418851 GGGATCATGTTGTTATAATGA pLKO_005 217 CDS 100% 5.625 3.938 N MRPL13 n/a
8 TRCN0000436364 CATAAACCTGTGTACCATGCA pLKO_005 183 CDS 100% 2.640 1.848 N MRPL13 n/a
9 TRCN0000117401 GCATCTATAAGACTTCAGGGA pLKO.1 159 CDS 100% 0.660 0.396 N MRPL13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014078.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03063 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03063 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471306 CATGCCTACTCTTAACTAACACAA pLX_317 95.8% 100% 100% V5 n/a
Download CSV