Transcript: Human NM_014117.3

Homo sapiens chromosome 16 open reading frame 72 (C16orf72), mRNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
C16orf72 (29035)
Length:
5952
CDS:
402..1229

Additional Resources:

NCBI RefSeq record:
NM_014117.3
NBCI Gene record:
C16orf72 (29035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014117.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267848 GGCTATCAGCGACGCAATAAG pLKO_005 756 CDS 100% 13.200 18.480 N 1810013L24Rik n/a
2 TRCN0000365289 GGCTATCAGCGACGCAATAAG pLKO_005 756 CDS 100% 13.200 18.480 N C16orf72 n/a
3 TRCN0000370373 CCGTCACCAATCTCTACAAAG pLKO_005 688 CDS 100% 10.800 15.120 N C16orf72 n/a
4 TRCN0000370374 TCGTTAGCAAGATCATCATAG pLKO_005 1461 3UTR 100% 10.800 15.120 N C16orf72 n/a
5 TRCN0000267801 TGGACTCCATGATGTCGATTT pLKO_005 1082 CDS 100% 10.800 15.120 N 1810013L24Rik n/a
6 TRCN0000365230 TGGACTCCATGATGTCGATTT pLKO_005 1082 CDS 100% 10.800 15.120 N C16orf72 n/a
7 TRCN0000137320 GATGTCATTACAGACTCACCA pLKO.1 1182 CDS 100% 2.640 2.112 N C16orf72 n/a
8 TRCN0000346147 AGTGGTGCAATGGCTAGTATA pLKO_005 990 CDS 100% 13.200 9.240 N 1810013L24Rik n/a
9 TRCN0000365250 CAGACTCACCAACCCATAAAC pLKO_005 1192 CDS 100% 13.200 9.240 N C16orf72 n/a
10 TRCN0000365252 CCACTTGATCCTCAACATATA pLKO_005 1268 3UTR 100% 13.200 9.240 N C16orf72 n/a
11 TRCN0000370372 CTCATCTGTAGAGACTGATTT pLKO_005 932 CDS 100% 13.200 9.240 N C16orf72 n/a
12 TRCN0000137822 GCTCAGCAGTAGAAGCGTAAT pLKO.1 3522 3UTR 100% 10.800 7.560 N C16orf72 n/a
13 TRCN0000168418 GCTCATCTGTAGAGACTGATT pLKO.1 931 CDS 100% 4.950 3.465 N C16orf72 n/a
14 TRCN0000134064 GCTGTTAGGTAGACCTAAATA pLKO.1 2345 3UTR 100% 1.500 1.050 N C16orf72 n/a
15 TRCN0000365251 TGGTGCAATGGCTAGTATAAG pLKO_005 992 CDS 100% 13.200 7.920 N C16orf72 n/a
16 TRCN0000138493 CGAAGGAGAAATGGACTCCAT pLKO.1 1071 CDS 100% 2.640 1.584 N C16orf72 n/a
17 TRCN0000267849 GATCCTCAACATATACTATTA pLKO_005 1274 3UTR 100% 13.200 9.240 N 1810013L24Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014117.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03065 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03065 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466251 ACCCCGAATGCTCAGGTGATCTTA pLX_317 41.8% 100% 100% V5 n/a
Download CSV