Transcript: Human NM_014181.3

Homo sapiens galectin like (LGALSL), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
LGALSL (29094)
Length:
3856
CDS:
385..903

Additional Resources:

NCBI RefSeq record:
NM_014181.3
NBCI Gene record:
LGALSL (29094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262652 CGGGTATGTAAGGTGTTATTT pLKO_005 3303 3UTR 100% 15.000 21.000 N LGALSL n/a
2 TRCN0000111118 CCACGACTGATAGTTCCATTT pLKO.1 484 CDS 100% 10.800 15.120 N Lgalsl n/a
3 TRCN0000325994 CCACGACTGATAGTTCCATTT pLKO_005 484 CDS 100% 10.800 15.120 N Lgalsl n/a
4 TRCN0000183830 CATTCAAACGTTATCTGCAAT pLKO.1 834 CDS 100% 4.950 6.930 N LGALSL n/a
5 TRCN0000262651 ACTAGATGATGGCCATTTAAA pLKO_005 423 CDS 100% 15.000 10.500 N LGALSL n/a
6 TRCN0000281549 ATCTGCAATTGACACCATAAA pLKO_005 846 CDS 100% 13.200 9.240 N LGALSL n/a
7 TRCN0000282362 TGTACTTCCCACGACTGATAG pLKO_005 476 CDS 100% 10.800 7.560 N LGALSL n/a
8 TRCN0000148666 CAGTCAGCAATCCCTTACTTT pLKO.1 712 CDS 100% 5.625 3.938 N LGALSL n/a
9 TRCN0000179710 GATGTGGCAATCGAACTCAAA pLKO.1 628 CDS 100% 4.950 3.465 N LGALSL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03077 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03077 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472163 TAATTCTATATAGTGAACGACCCC pLX_317 97.2% 100% 100% V5 n/a
Download CSV